CD11b (Integrin alpha M, ITGAM)

Short Description: This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009].
More information related to gene CD11b.
Products related to CD11b Gene:
124 Products
Data Quality
  • 3
Type
  • 119
  • 5
Species
  • 59
  • 40
  • 25
Application
  • 70
  • 26
  • 23
  • 16
  • 1
Fusion tag
  • 39
  • 18
  • 14
  • 14
  • 8
Vector Backbone
  • 9
  • 9
  • 8
  • 6
  • 6
Vector
  • 41
  • 41
  • 16
  • 9
  • 8
Insert
  • 46
  • 38
  • 19
  • 8
  • 6
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 59
  • 33
  • 24
  • 3
  • 2
Expression Type
  • 97
  • 53
  • 10
Selectable Marker
  • 30
  • 26
  • 10
  • 8
Promoter
  • 42
  • 29
  • 18
  • 17
  • 8
Format
  • 54
  • 32
  • 24
  • 14

Type:
cDNA
Application:
Cloning
Gene:
Integrin alpha M (ITGAM)
Gene ID:
3684 (Human, ITGAM)
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985851
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Integrin alpha M (ITGAM)
Gene ID:
3684 (Human, ITGAM)
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985856
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Integrin alpha M (ITGAM)
Gene ID:
3684 (Human, ITGAM)
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985857
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Integrin alpha M (ITGAM)
Gene ID:
3684 (Human, ITGAM)
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985858
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Integrin alpha M (ITGAM)
NCBI Accession:
NM_000632
Species:
Human
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561333
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Integrin alpha M
Species:
Human
Synonyms:
CD11b/CD18, CR3, CR3A, Cd11b, F730045J24Rik, Ly-40, MAC1, Mac-1, Mac-1a, CD11B, MAC-1, MAC1A, MO1A, SLEB6, C3bi
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188850
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Integrin alpha M (ITGAM)
Gene ID:
3684 (Human, ITGAM)
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985852
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Integrin alpha M (ITGAM)
Gene ID:
3684 (Human, ITGAM)
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985853
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Integrin alpha M (ITGAM)
Gene ID:
3684 (Human, ITGAM)
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985854
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Integrin alpha M (ITGAM)
Gene ID:
3684 (Human, ITGAM)
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985855
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Integrin alpha M (ITGAM)
Gene ID:
3684 (Human, ITGAM)
Synonyms:
ITGAM, Itgam, LOC100351865
Insert length:
3459 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5324263
$218.77
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Integrin alpha M (ITGAM)
Gene ID:
16409 (Mouse (Murine), ITGAM)
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3433522
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Integrin alpha M (ITGAM)
Gene ID:
16409 (Mouse (Murine), ITGAM)
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3433714
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Integrin alpha M (ITGAM)
NCBI Accession:
NM_000632
Species:
Human
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3912868
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Integrin alpha M (ITGAM)
NCBI Accession:
NM_000632
Species:
Human
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3912875
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Integrin alpha M (ITGAM)
NCBI Accession:
NM_000632
Species:
Human
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3912876
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Integrin alpha M (ITGAM)
NCBI Accession:
NM_000632
Species:
Human
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3912877
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Integrin alpha M (ITGAM)
NCBI Accession:
NM_000632
Species:
Human
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3912870
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Integrin alpha M (ITGAM)
NCBI Accession:
NM_000632
Species:
Human
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3912871
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Integrin alpha M (ITGAM)
NCBI Accession:
NM_000632
Species:
Human
Synonyms:
ITGAM, Itgam, LOC100351865
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3912872
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to CD11b

  • integrin subunit alpha M (ITGAM)
  • integrin alpha M (Itgam)
  • integrin subunit alpha M (Itgam)
  • integrin, alpha M (complement component 3 receptor 3 subunit) (ITGAM)
  • integrin alpha-M (LOC100351865)
  • C3bi
  • Cd11b
  • CD11B
  • CD11b/CD18
  • CR3
  • CR3A
  • F730045J24Rik
  • Ly-40
  • Mac-1
  • MAC-1
  • Mac-1a
  • MAC1
  • MAC1A
  • MO1A
  • SLEB6

Gene-IDs for different species

GENE IDSPECIES
454069 Pan troglodytes
16409 Mus musculus
25021 Rattus norvegicus
3684 Homo sapiens
407124 Bos taurus
443217 Ovis aries
397459 Sus scrofa
489928 Canis lupus familiaris
100351865 Oryctolagus cuniculus
100135561 Cavia porcellus

Protein level used designations for CD11b

  • MAC-1 alpha subunit
  • integrin alpha M
  • integrin alpha-M
  • CD11 antigen-like family member B
  • CD11B (p170)
  • CR-3 alpha chain
  • Mac-1 alpha
  • cell surface glycoprotein MAC-1 alpha subunit
  • cell surface glycoprotein MAC-1 subunit alpha
  • complement component receptor 3 alpha-a
  • complement receptor type 3
  • leukocyte adhesion receptor MO1
  • macrophage antigen alpha
  • antigen CD11b (p170)
  • macrophage antigen alpha polypeptide
  • neutrophil adherence receptor alpha-M subunit
  • leukocyte integrin alpha-M chain
  • complement receptor 3
  • leukocyte integrin alpha M
Other products related to CD11b such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com