CD20 (Membrane-Spanning 4-Domains, Subfamily A, Member 1, MS4A1)

Short Description: This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008].
More information related to gene CD20.
Products related to CD20 Gene:
154 Products
Type
  • 149
  • 5
Species
  • 61
  • 41
  • 26
  • 12
  • 12
Application
  • 103
  • 26
  • 23
  • 18
  • 2
Fusion tag
  • 46
  • 18
  • 17
  • 13
  • 11
Vector Backbone
  • 8
  • 8
  • 8
  • 6
  • 6
Vector
  • 73
  • 42
  • 12
  • 9
  • 5
Insert
  • 74
  • 37
  • 20
  • 10
  • 6
Oligo-Type
  • 3
  • 2
Resistance Gene
  • 75
  • 45
  • 24
  • 5
  • 2
Expression Type
  • 95
  • 53
  • 44
Selectable Marker
  • 44
  • 28
  • 25
  • 1
Promoter
  • 54
  • 36
  • 32
  • 14
  • 10
Format
  • 87
  • 27
  • 26
  • 14

Type:
ORF
Application:
Cloning
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
Species:
Human
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Insert length:
894 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5738766
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
NCBI Accession:
NM_021950,NP_068769
Species:
Human
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Insert length:
894 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5395727
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
NCBI Accession:
NM_021950
Gene ID:
931 (Human, MS4A1)
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Insert length:
894 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4918938
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
Gene ID:
12482 (Mouse (Murine), MS4A1)
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463085
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
Gene ID:
505653 (Cow (Bovine), MS4A1)
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3854506
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
Gene ID:
931 (Human, MS4A1)
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083572
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
NCBI Accession:
XM_001086364
Species:
Rhesus Monkey
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562541
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
NCBI Accession:
XM_004770405
Species:
Ferret
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562542
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
NCBI Accession:
NM_007641
Species:
Mouse (Murine)
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3546045
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
NCBI Accession:
NM_021950
Species:
Human
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887377
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1
Species:
Mouse (Murine)
Synonyms:
B1, Bp35, CD20, CVID5, LEU-16, MS4A2, S7, AA960661, Cd20, Ly-44, Ms4a2, MS4A1, bp35, cd20, ms4a2, leu-16, ms4a4c, cd20-like
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193973
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1
Species:
Human
Synonyms:
B1, Bp35, CD20, CVID5, LEU-16, MS4A2, S7, AA960661, Cd20, Ly-44, Ms4a2, MS4A1, bp35, cd20, ms4a2, leu-16, ms4a4c, cd20-like
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189304
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
Gene ID:
12482 (Mouse (Murine), MS4A1)
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463086
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
Gene ID:
505653 (Cow (Bovine), MS4A1)
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3854507
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
Gene ID:
931 (Human, MS4A1)
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083573
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
Gene ID:
931 (Human, MS4A1)
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Insert length:
894 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316168
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
NCBI Accession:
NM_021950
Species:
Human
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3923472
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
NCBI Accession:
NM_021950
Species:
Human
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3923473
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
NCBI Accession:
NM_021950
Species:
Human
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3923475
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Membrane-Spanning 4-Domains, Subfamily A, Member 1 (MS4A1)
NCBI Accession:
NM_021950
Species:
Human
Synonyms:
MS4A1, Ms4a1, ms4a1, LOC101694281
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3923476
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to CD20

  • membrane spanning 4-domains A1 (MS4A1)
  • membrane-spanning 4-domains, subfamily A, member 1 (Ms4a1)
  • membrane spanning 4-domains A1 (Ms4a1)
  • membrane-spanning 4-domains, subfamily A, member 1 (MS4A1)
  • membrane spanning 4-domains A1 (ms4a1)
  • B-lymphocyte antigen CD20 (LOC101694281)
  • AA960661
  • B1
  • bp35
  • Bp35
  • CD20
  • cd20
  • Cd20
  • cd20-like
  • CVID5
  • LEU-16
  • leu-16
  • Ly-44
  • MS4A1
  • MS4A2
  • Ms4a2
  • ms4a2
  • ms4a4c
  • S7

Gene-IDs for different species

GENE IDSPECIES
931 Homo sapiens
12482 Mus musculus
309217 Rattus norvegicus
451223 Pan troglodytes
485430 Canis lupus familiaris
496881 Xenopus (Silurana) tropicalis
100059000 Equus caballus
100357719 Oryctolagus cuniculus
505653 Bos taurus
100627952 Sus scrofa
102118491 Macaca fascicularis
696843 Macaca mulatta
101694281 Mustela putorius furo
494216 Felis catus

Protein level used designations for CD20

  • B-lymphocyte antigen CD20
  • B-lymphocyte cell-surface antigen B1
  • CD20 antigen
  • CD20 receptor
  • leukocyte surface antigen Leu-16
  • B-cell differentiation antigen Ly-44
  • lymphocyte antigen 44
  • membrane-spanning 4-domains, subfamily A, member 2
  • membrane-spanning 4-domains, subfamily A, member 1
  • membrane-spanning 4-domains subfamily A member 1
  • membrane-spanning 4-domains, subfamily A, member 4C
  • B-lymphocyte surface antigen B1
  • Membrane-spanning 4-domains subfamily A member 1
  • CD20 cell surface protein
Other products related to CD20 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com