CD5 (CD5 Molecule, CD5)

Short Description: May act as a receptor in regulating T-cell proliferation.
More information related to gene CD5.
Products related to CD5 Gene:
149 Products
Data Quality
  • 1
Type
  • 141
  • 8
Species
  • 49
  • 43
  • 43
  • 12
  • 2
Application
  • 97
  • 27
  • 26
  • 16
  • 3
Fusion tag
  • 47
  • 17
  • 16
  • 11
  • 10
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 76
  • 35
  • 12
  • 9
  • 4
Insert
  • 65
  • 39
  • 21
  • 8
  • 6
Oligo-Type
  • 5
  • 3
Resistance Gene
  • 76
  • 44
  • 18
  • 3
  • 2
Expression Type
  • 91
  • 49
  • 44
Selectable Marker
  • 44
  • 26
  • 25
Promoter
  • 57
  • 31
  • 31
  • 13
  • 8
Format
  • 86
  • 27
  • 22
  • 14

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD5 Molecule (CD5)
Gene ID:
921 (Human, CD5)
Synonyms:
CD5, Cd5, CD5L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803400
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD5 Molecule (CD5)
Gene ID:
12507 (Mouse (Murine), CD5)
Synonyms:
CD5, Cd5, CD5L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463099
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD5 Molecule (CD5)
Gene ID:
54236 (Rat (Rattus), CD5)
Synonyms:
CD5, Cd5, CD5L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046526
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD5 Molecule (CD5)
Gene ID:
280745 (Cow (Bovine), CD5)
Synonyms:
CD5, Cd5, CD5L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048803
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD5 Molecule (CD5)
NCBI Accession:
NM_019295
Species:
Rat (Rattus)
Synonyms:
CD5, Cd5, CD5L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887693
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD5 Molecule (CD5)
NCBI Accession:
XM_001083880
Species:
Rhesus Monkey
Synonyms:
CD5, Cd5, CD5L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103985
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD5 Molecule (CD5)
NCBI Accession:
NM_014207
Species:
Human
Synonyms:
CD5, Cd5, CD5L
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103797
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD5 Molecule (CD5)
NCBI Accession:
NM_007650
Species:
Mouse (Murine)
Synonyms:
CD5, Cd5, CD5L
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103798
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
CD5 Molecule
Species:
Mouse (Murine)
Synonyms:
CD5, Ly-1, Ly-12, Ly-A, Lyt-1, LEU1, T1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193976
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
CD5 Molecule
Species:
Rat (Rattus)
Synonyms:
CD5, Ly-1, Ly-12, Ly-A, Lyt-1, LEU1, T1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196505
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
CD5 Molecule
Species:
Human
Synonyms:
CD5, Ly-1, Ly-12, Ly-A, Lyt-1, LEU1, T1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189321
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD5 Molecule (CD5)
Gene ID:
921 (Human, CD5)
Synonyms:
CD5, Cd5, CD5L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803399
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD5 Molecule (CD5)
Gene ID:
12507 (Mouse (Murine), CD5)
Synonyms:
CD5, Cd5, CD5L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463097
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD5 Molecule (CD5)
Gene ID:
54236 (Rat (Rattus), CD5)
Synonyms:
CD5, Cd5, CD5L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046527
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD5 Molecule (CD5)
Gene ID:
280745 (Cow (Bovine), CD5)
Synonyms:
CD5, Cd5, CD5L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048804
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD5 Molecule (CD5)
NCBI Accession:
XM_001083880
Species:
Rhesus Monkey
Synonyms:
CD5, Cd5, CD5L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3926456
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD5 Molecule (CD5)
NCBI Accession:
XM_001083880
Species:
Rhesus Monkey
Synonyms:
CD5, Cd5, CD5L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3926458
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD5 Molecule (CD5)
NCBI Accession:
XM_001083880
Species:
Rhesus Monkey
Synonyms:
CD5, Cd5, CD5L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3926459
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD5 Molecule (CD5)
NCBI Accession:
XM_001083880
Species:
Rhesus Monkey
Synonyms:
CD5, Cd5, CD5L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3926460
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD5 Molecule (CD5)
NCBI Accession:
XM_001083880
Species:
Rhesus Monkey
Synonyms:
CD5, Cd5, CD5L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3926462
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to CD5

  • CD5 molecule (CD5)
  • CD5 antigen (Cd5)
  • CD5 molecule like (CD5L)
  • Cd5 molecule (Cd5)
  • CD5
  • LEU1
  • Ly-1
  • Ly-12
  • Ly-A
  • Lyt-1
  • T1

Gene-IDs for different species

GENE IDSPECIES
695249 Macaca mulatta
737721 Pan troglodytes
100446127 Pongo abelii
100590674 Nomascus leucogenys
12507 Mus musculus
100054450 Equus caballus
921 Homo sapiens
54236 Rattus norvegicus
101083293 Felis catus
395757 Gallus gallus
443328 Ovis aries
612338 Canis lupus familiaris
280745 Bos taurus
100008958 Oryctolagus cuniculus
100513336 Sus scrofa

Protein level used designations for CD5

  • CD5 molecule
  • t-cell surface glycoprotein CD5-like
  • T-cell surface glycoprotein CD5
  • lymphocyte antigen 1
  • CD5 antigen (p56-62)
  • lymphocyte antigen T1/Leu-1
  • CD5 antigen
  • Lymphocyte antigen CD5
  • CD74 antigen, invariant polypeptide of major
  • lymphocyte receptor CD5
Other products related to CD5 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com