CD63 (CD63 Molecule, CD63)

Short Description: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The encoded protein is a cell surface glycoprotein that is known to complex with integrins. It may function as a blood platelet activation marker. Deficiency of this protein is associated with Hermansky-Pudlak syndrome. Also this gene has been associated with tumor progression. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Apr 2012].
More information related to gene CD63.
Products related to CD63 Gene:
194 Products
Data Quality
  • 1
Type
  • 185
  • 9
Species
  • 70
  • 57
  • 43
  • 12
  • 4
Application
  • 128
  • 44
  • 27
  • 16
  • 3
Fusion tag
  • 62
  • 25
  • 20
  • 19
  • 12
Vector Backbone
  • 11
  • 8
  • 8
  • 8
  • 7
Vector
  • 103
  • 39
  • 16
  • 12
  • 9
Insert
  • 88
  • 60
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 3
Resistance Gene
  • 93
  • 58
  • 30
  • 4
  • 2
Expression Type
  • 125
  • 63
  • 46
  • 2
Selectable Marker
  • 46
  • 39
  • 26
Promoter
  • 64
  • 55
  • 31
  • 17
  • 8
Format
  • 108
  • 36
  • 26
  • 24

Type:
ORF
Application:
Cloning
Gene:
CD63 Molecule (CD63)
Species:
Human
Synonyms:
Cd63, CD63
Insert length:
717 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5755154
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD63 Molecule (CD63)
NCBI Accession:
NM_001780,NP_001771
Species:
Human
Synonyms:
Cd63, CD63
Insert length:
717 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5449411
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
CD63 Molecule (CD63)
NCBI Accession:
NM_001780
Gene ID:
967 (Human, CD63)
Synonyms:
Cd63, CD63
Insert length:
717 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4920222
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
CD63 Molecule (CD63)
NCBI Accession:
NM_001257401
Gene ID:
967 (Human, CD63)
Synonyms:
Cd63, CD63
Insert length:
471 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4920223
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD63 Molecule (CD63)
Gene ID:
321461 (Zebrafish (Danio rerio), CD63)
Synonyms:
Cd63, CD63
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3876931
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD63 Molecule (CD63)
Gene ID:
321461 (Zebrafish (Danio rerio), CD63)
Synonyms:
Cd63, CD63
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4054021
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD63 Molecule (CD63)
Gene ID:
12512 (Mouse (Murine), CD63)
Synonyms:
Cd63, CD63
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463105
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD63 Molecule (CD63)
Gene ID:
404156 (Cow (Bovine), CD63)
Synonyms:
Cd63, CD63
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3847158
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD63 Molecule (CD63)
Gene ID:
404156 (Cow (Bovine), CD63)
Synonyms:
Cd63, CD63
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3847159
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD63 Molecule (CD63)
Gene ID:
549167 (Xenopus tropicalis, CD63)
Synonyms:
Cd63, CD63
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4030317
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD63 Molecule (CD63)
Gene ID:
29186 (Rat (Rattus), CD63)
Synonyms:
Cd63, CD63
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037138
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD63 Molecule (CD63)
Gene ID:
967 (Human, CD63)
Synonyms:
Cd63, CD63
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083591
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD63 Molecule (CD63)
Gene ID:
967 (Human, CD63)
Synonyms:
Cd63, CD63
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083590
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD63 Molecule (CD63)
Gene ID:
380212 (Xenopus laevis, CD63)
Synonyms:
Cd63, CD63
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041193
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD63 Molecule (CD63)
NCBI Accession:
XM_001111318
Species:
Rhesus Monkey
Synonyms:
Cd63, CD63
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558301
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD63 Molecule (CD63)
NCBI Accession:
NM_001780
Species:
Human
Synonyms:
Cd63, CD63
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558302
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD63 Molecule (CD63)
NCBI Accession:
NM_017125
Species:
Rat (Rattus)
Synonyms:
Cd63, CD63
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887699
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD63 Molecule (CD63)
NCBI Accession:
NM_001042580
Species:
Mouse (Murine)
Synonyms:
Cd63, CD63
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886523
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
CD63 Molecule
Species:
Rat (Rattus)
Synonyms:
C75951, ME491, Tspan30, LAMP-3, MLA1, OMA81H, TSPAN30, TSP29FA
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196444
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
CD63 Molecule
Species:
Mouse (Murine)
Synonyms:
C75951, ME491, Tspan30, LAMP-3, MLA1, OMA81H, TSPAN30, TSP29FA
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194105
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
  • <
  • 1

Synonyms and alternative names related to CD63

  • CD63 antigen (Cd63)
  • CD63 molecule (CD63)
  • Cd63 molecule (Cd63)
  • CD63 molecule (Cd63)
  • C75951
  • LAMP-3
  • ME491
  • MLA1
  • OMA81H
  • TSP29FA
  • Tspan30
  • TSPAN30

Gene-IDs for different species

GENE IDSPECIES
12512 Mus musculus
100155929 Sus scrofa
100051450 Equus caballus
967 Homo sapiens
404156 Bos taurus
493846 Felis catus
100008988 Oryctolagus cuniculus
29186 Rattus norvegicus
474391 Canis lupus familiaris
101114944 Ovis aries
100716198 Cavia porcellus

Protein level used designations for CD63

  • melanoma 1 antigen
  • CD63 antigen
  • CD63 antigen (melanoma 1 antigen)
  • granulophysin
  • lysosomal-associated membrane protein 3
  • lysosome-associated membrane glycoprotein 3
  • melanoma-associated antigen ME491
  • melanoma-associated antigen MLA1
  • ocular melanoma-associated antigen
  • tetraspanin-30
  • tspan-30
  • ME491/CD63 antigen
  • mast cell antigen AD1
Other products related to CD63 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com