CD86 (CD86 Molecule, CD86)

Short Description: This gene encodes a type I membrane protein that is a member of the immunoglobulin superfamily. This protein is expressed by antigen-presenting cells, and it is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of this protein with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of this protein with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response. Alternative splicing results in several transcript variants encoding different isoforms.[provided by RefSeq, May 2011].
More information related to gene CD86.
Products related to CD86 Gene:
158 Products
Type
  • 150
  • 8
Species
  • 64
  • 43
  • 39
  • 12
Application
  • 106
  • 25
  • 24
  • 16
  • 3
Fusion tag
  • 45
  • 19
  • 17
  • 14
  • 13
Vector Backbone
  • 9
  • 6
  • 6
  • 6
  • 6
Vector
  • 84
  • 35
  • 12
  • 9
  • 4
Insert
  • 78
  • 36
  • 20
  • 8
  • 6
Oligo-Type
  • 5
  • 3
Resistance Gene
  • 80
  • 48
  • 18
  • 4
  • 2
Expression Type
  • 99
  • 56
  • 44
Selectable Marker
  • 44
  • 33
  • 26
Promoter
  • 54
  • 42
  • 30
  • 13
  • 8
Format
  • 101
  • 27
  • 20
  • 10

Type:
ORF
Application:
Cloning
Gene:
CD86 Molecule (CD86)
Species:
Human
Synonyms:
CD86, Cd86
Insert length:
990 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5749558
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD86 Molecule (CD86)
Gene ID:
942 (Human, CD86)
Synonyms:
CD86, Cd86
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803408
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD86 Molecule (CD86)
Gene ID:
12524 (Mouse (Murine), CD86)
Synonyms:
CD86, Cd86
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3807972
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD86 Molecule (CD86)
NCBI Accession:
NM_001042644
Species:
Rhesus Monkey
Synonyms:
CD86, Cd86
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558310
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD86 Molecule (CD86)
Species:
Mouse (Murine)
Synonyms:
CD86, Cd86
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558311
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD86 Molecule (CD86)
NCBI Accession:
NM_020081
Species:
Rat (Rattus)
Synonyms:
CD86, Cd86
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886531
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD86 Molecule (CD86)
NCBI Accession:
NM_006889
Species:
Human
Synonyms:
CD86, Cd86
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887714
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
CD86 Molecule
NCBI Accession:
NM_175862, NM_006889, NM_001206925
Species:
Human
Synonyms:
B7-2, B7, B7.2, B70, CLS1, Cd28l2, ETC-1, Ly-58, Ly58, MB7, MB7-2, TS/A-2, CD28LG2, LAB72
PCR Size:
127 bp
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188434
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
CD86 Molecule
Species:
Mouse (Murine)
Synonyms:
B7-2, B7, B7.2, B70, CLS1, Cd28l2, ETC-1, Ly-58, Ly58, MB7, MB7-2, TS/A-2, CD28LG2, LAB72
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193655
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
CD86 Molecule
Species:
Rat (Rattus)
Synonyms:
B7-2, B7, B7.2, B70, CLS1, Cd28l2, ETC-1, Ly-58, Ly58, MB7, MB7-2, TS/A-2, CD28LG2, LAB72
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196189
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD86 Molecule (CD86)
Gene ID:
942 (Human, CD86)
Synonyms:
CD86, Cd86
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803410
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD86 Molecule (CD86)
Gene ID:
12524 (Mouse (Murine), CD86)
Synonyms:
CD86, Cd86
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3807971
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
CD86 Molecule (CD86)
Gene ID:
942 (Human, CD86)
Synonyms:
CD86, Cd86
Insert length:
990 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5314409
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
CD86 Molecule (CD86)
NCBI Accession:
NM_175862
Gene ID:
942 (Human, CD86)
Synonyms:
CD86, Cd86
Insert length:
990 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4931697
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
CD86 Molecule (CD86)
NCBI Accession:
NM_176892
Gene ID:
942 (Human, CD86)
Synonyms:
CD86, Cd86
Insert length:
828 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4931698
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
CD86 Molecule (CD86)
NCBI Accession:
NM_001206924
Gene ID:
942 (Human, CD86)
Synonyms:
CD86, Cd86
Insert length:
654 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4931699
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
CD86 Molecule (CD86)
NCBI Accession:
NM_001206925
Gene ID:
942 (Human, CD86)
Synonyms:
CD86, Cd86
Insert length:
744 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4940795
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD86 Molecule (CD86)
NCBI Accession:
NM_020081
Species:
Rat (Rattus)
Synonyms:
CD86, Cd86
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3972027
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD86 Molecule (CD86)
NCBI Accession:
NM_020081
Species:
Rat (Rattus)
Synonyms:
CD86, Cd86
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3972028
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD86 Molecule (CD86)
NCBI Accession:
NM_020081
Species:
Rat (Rattus)
Synonyms:
CD86, Cd86
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3972030
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to CD86

  • CD86 molecule (CD86)
  • CD86 antigen (Cd86)
  • CD86 molecule (Cd86)
  • B7
  • B7-2
  • B7.2
  • B70
  • Cd28l2
  • CD28LG2
  • CLS1
  • ETC-1
  • LAB72
  • Ly-58
  • Ly58
  • MB7
  • MB7-2
  • TS/A-2

Gene-IDs for different species

GENE IDSPECIES
470900 Pan troglodytes
493704 Felis catus
714390 Macaca mulatta
12524 Mus musculus
942 Homo sapiens
56822 Rattus norvegicus
403764 Canis lupus familiaris
397441 Sus scrofa
414345 Bos taurus
100008999 Oryctolagus cuniculus
554318 Ovis aries

Protein level used designations for CD86

  • CD86 antigen
  • T-lymphocyte activation antigen CD86
  • activation B7-2 antigen
  • early T cell costimulatory molecule-1
  • early T-cell costimulatory molecule 1
  • B-lymphocyte activation antigen B7-2
  • BU63
  • CD86 antigen (CD28 antigen ligand 2, B7-2 antigen)
  • CTLA-4 counter-receptor B7.2
  • FUN-1
  • cd86 antigen
  • membrane glycoprotein
  • B7-2 protein
  • co-stimulatory molecule B7-2
  • costimulatory molecule
  • CD86/B7-2 costimulatory molecule
  • B7-1 costimulatory molecule
Other products related to CD86 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com