CDHR5 (Mucin and Cadherin-Like, CDHR5)

Short Description: This gene is a novel mucin-like gene that is a member of the cadherin superfamily. While encoding nonpolymorphic tandem repeats rich in proline, serine and threonine similar to mucin proteins, the gene also contains sequence encoding calcium-binding motifs found in all cadherins. The role of the hybrid extracellular region and the specific function of this protein have not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jan 2010].
More information related to gene CDHR5.
Products related to CDHR5 Gene:
127 Products
Type
  • 121
  • 6
Species
  • 58
  • 39
  • 28
  • 2
Application
  • 82
  • 26
  • 25
  • 20
Fusion tag
  • 47
  • 21
  • 15
  • 11
  • 6
Vector Backbone
  • 9
  • 9
  • 9
  • 8
  • 8
Vector
  • 52
  • 43
  • 12
  • 9
  • 4
Insert
  • 41
  • 41
  • 19
  • 10
  • 8
Oligo-Type
  • 6
Resistance Gene
  • 49
  • 44
  • 24
  • 4
  • 2
Expression Type
  • 108
  • 53
  • 11
Selectable Marker
  • 32
  • 26
  • 11
Promoter
  • 41
  • 35
  • 29
  • 13
  • 10
Format
  • 59
  • 27
  • 27
  • 14

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mucin and Cadherin-Like (CDHR5)
Gene ID:
171554 (Rat (Rattus), CDHR5)
Synonyms:
CDHR5, Cdhr5
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048396
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mucin and Cadherin-Like (CDHR5)
Gene ID:
53841 (Human, CDHR5)
Synonyms:
CDHR5, Cdhr5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815276
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mucin and Cadherin-Like (CDHR5)
Gene ID:
72040 (Mouse (Murine), CDHR5)
Synonyms:
CDHR5, Cdhr5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3824308
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mucin and Cadherin-Like (CDHR5)
Gene ID:
72040 (Mouse (Murine), CDHR5)
Synonyms:
CDHR5, Cdhr5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3824309
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mucin and Cadherin-Like (CDHR5)
Gene ID:
100125282 (Cow (Bovine), CDHR5)
Synonyms:
CDHR5, Cdhr5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872824
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mucin and Cadherin-Like (CDHR5)
NCBI Accession:
NM_001114322
Species:
Mouse (Murine)
Synonyms:
CDHR5, Cdhr5
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558372
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mucin and Cadherin-Like (CDHR5)
Gene ID:
171554 (Rat (Rattus), CDHR5)
Synonyms:
CDHR5, Cdhr5
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048397
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mucin and Cadherin-Like (CDHR5)
Gene ID:
53841 (Human, CDHR5)
Synonyms:
CDHR5, Cdhr5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815274
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mucin and Cadherin-Like (CDHR5)
Gene ID:
72040 (Mouse (Murine), CDHR5)
Synonyms:
CDHR5, Cdhr5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3824310
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mucin and Cadherin-Like (CDHR5)
Gene ID:
72040 (Mouse (Murine), CDHR5)
Synonyms:
CDHR5, Cdhr5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3824313
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mucin and Cadherin-Like (CDHR5)
Gene ID:
100125282 (Cow (Bovine), CDHR5)
Synonyms:
CDHR5, Cdhr5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872823
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mucin and Cadherin-Like (CDHR5)
Gene ID:
53841 (Human, CDHR5)
Synonyms:
CDHR5, Cdhr5
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3412075
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mucin and Cadherin-Like (CDHR5)
NCBI Accession:
NM_028069
Species:
Mouse (Murine)
Synonyms:
CDHR5, Cdhr5
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Cdhr5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5120954
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mucin and Cadherin-Like (CDHR5)
NCBI Accession:
NM_021924
Species:
Human
Synonyms:
CDHR5, Cdhr5
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MUPCDH
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5120950
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mucin and Cadherin-Like (CDHR5)
NCBI Accession:
NM_001171968
Species:
Human
Synonyms:
CDHR5, Cdhr5
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of CDHR5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5120952
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mucin and Cadherin-Like (CDHR5)
NCBI Accession:
NM_138525
Species:
Rat (Rattus)
Synonyms:
CDHR5, Cdhr5
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mucdhl
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5120956
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Application:
RNA Interference
Gene:
Mucin and Cadherin-Like
Species:
Human
Synonyms:
MU-PCDH, MUCDHL, MUPCDH, 1810074H01Rik, AI481143, Mucdhl, Mupcdh
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • CDHR5 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3286043
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Mucin and Cadherin-Like
Species:
Mouse (Murine)
Synonyms:
MU-PCDH, MUCDHL, MUPCDH, 1810074H01Rik, AI481143, Mucdhl, Mupcdh
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Mupcdh (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3347370
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Mucin and Cadherin-Like
Species:
Rat (Rattus)
Synonyms:
MU-PCDH, MUCDHL, MUPCDH, 1810074H01Rik, AI481143, Mucdhl, Mupcdh
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Mucdhl (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3353600
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mucin and Cadherin-Like (CDHR5)
NCBI Accession:
NM_031264,NP_112554
Species:
Human
Synonyms:
CDHR5, Cdhr5
Insert length:
1956 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5405475
$480.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to CDHR5

  • cadherin related family member 5 (CDHR5)
  • cadherin-related family member 5 (Cdhr5)
  • 1810074H01Rik
  • AI481143
  • MU-PCDH
  • MUCDHL
  • Mucdhl
  • MUPCDH
  • Mupcdh

Gene-IDs for different species

GENE IDSPECIES
53841 Homo sapiens
72040 Mus musculus
171554 Rattus norvegicus

Protein level used designations for CDHR5

  • mu-protocadherin
  • mucin and cadherin-like protein
  • mucin and cadherin like
  • mucin-like protocadherin
  • GP100
Other products related to CDHR5 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com