CMTM7 (CKLF-Like MARVEL Transmembrane Domain Containing 7, CMTM7)

Short Description: This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and transmembrane 4 superfamilies. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 3. The protein encoded by this gene is highly expressed in leukocytes, but its exact function is unknown. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008].
More information related to gene CMTM7.
Products related to CMTM7 Gene:
143 Products
  • 138
  • 5
  • 57
  • 54
  • 26
  • 2
  • 2
  • 88
  • 32
  • 24
  • 16
  • 1
Fusion tag
  • 46
  • 19
  • 16
  • 14
  • 8
Vector Backbone
  • 9
  • 9
  • 8
  • 6
  • 6
  • 62
  • 41
  • 16
  • 9
  • 8
  • 51
  • 51
  • 20
  • 8
  • 6
  • 4
  • 1
Resistance Gene
  • 65
  • 42
  • 26
  • 5
  • 2
Expression Type
  • 110
  • 54
  • 22
Selectable Marker
  • 33
  • 26
  • 22
  • 42
  • 38
  • 30
  • 18
  • 8
  • 68
  • 36
  • 26
  • 13
Supplier: Log in to see

CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5751762
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Protein Expression
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Insert length:
528 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5438429
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see
ISO 9001:2008

Protein Expression
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
Gene ID:
112616 (Human, CMTM7)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Insert length:
528 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4940479
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
Supplier: Log in to see

CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
102545 (Mouse (Murine), CMTM7)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4097900
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
112616 (Human, CMTM7)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4094369
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
446371 (Xenopus laevis, CMTM7)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3850993
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
532269 (Cow (Bovine), CMTM7)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3861885
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
548578 (Xenopus tropicalis, CMTM7)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4065466
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
Mouse (Murine)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3558672
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Quantitative real-time PCR
CKLF-Like MARVEL Transmembrane Domain Containing 7
CKLFSF7, im:7143001, si:dkey-11p23.3, AI481279, Cklfsf7, LNV, cklfsf7, cmtm7
-20 °C
Catalog No. ABIN3190279
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3558671
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Protein Expression, Cloning
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
446371 (Xenopus laevis, CMTM7)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3850994
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
532269 (Cow (Bovine), CMTM7)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3861886
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
548578 (Xenopus tropicalis, CMTM7)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4065467
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
112616 (Human, CMTM7)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4094370
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
112616 (Human, CMTM7)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Insert length:
528 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5315444
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Protein Expression
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
Mouse (Murine)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Insert length:
405 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3296767
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Protein Expression
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
Mouse (Murine)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3928668
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Protein Expression
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
Mouse (Murine)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
HA tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3928669
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Protein Expression
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
Mouse (Murine)
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3928672
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to CMTM7

  • CKLF like MARVEL transmembrane domain containing 7 (CMTM7)
  • CKLF-like MARVEL transmembrane domain containing 7 (cmtm7)
  • CKLF-like MARVEL transmembrane domain containing 7 (Cmtm7)
  • CKLF-like MARVEL transmembrane domain containing 7 L homeolog (cmtm7.L)
  • CKLF like MARVEL transmembrane domain containing 7 (Cmtm7)
  • AI481279
  • Cklfsf7
  • cklfsf7
  • cmtm7
  • im:7143001
  • LNV
  • si:dkey-11p23.3

Gene-IDs for different species

112616 Homo sapiens
420666 Gallus gallus
559138 Danio rerio
102545 Mus musculus
501065 Rattus norvegicus
446371 Xenopus laevis
532269 Bos taurus
100734875 Cavia porcellus

Protein level used designations for CMTM7

  • CKLF-like MARVEL transmembrane domain-containing protein 7
  • chemokine-like factor super family 7
  • chemokine-like factor super family member 7 variant 2
  • chemokine-like factor superfamily 7
  • chemokine-like factor superfamily member 7
  • CKLF-like MARVEL transmembrane domain containing 7 L homeolog
Other products related to CMTM7 such as antibodies, ELISA kits and high-purity proteins are available on our partner website