CMTM7 (CKLF-Like MARVEL Transmembrane Domain Containing 7, CMTM7)

Short Description: This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and transmembrane 4 superfamilies. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 3. The protein encoded by this gene is highly expressed in leukocytes, but its exact function is unknown. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008].
More information related to gene CMTM7.
Products related to CMTM7 Gene:
143 Products
Type
  • 138
  • 5
Species
  • 57
  • 54
  • 26
  • 2
  • 2
Application
  • 88
  • 32
  • 24
  • 16
  • 1
Fusion tag
  • 46
  • 19
  • 16
  • 14
  • 8
Vector Backbone
  • 9
  • 9
  • 8
  • 6
  • 6
Vector
  • 62
  • 41
  • 16
  • 9
  • 8
Insert
  • 51
  • 51
  • 20
  • 8
  • 6
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 65
  • 42
  • 26
  • 5
  • 2
Expression Type
  • 110
  • 54
  • 22
Selectable Marker
  • 33
  • 26
  • 22
Promoter
  • 42
  • 38
  • 30
  • 18
  • 8
Format
  • 68
  • 36
  • 26
  • 13

Type:
ORF
Application:
Protein Expression
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
NM_138410,NP_612419
Species:
Human
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Insert length:
528 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5438429
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
NM_138410
Gene ID:
112616 (Human, CMTM7)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Insert length:
528 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4940479
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
532269 (Cow (Bovine), CMTM7)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3861885
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
446371 (Xenopus laevis, CMTM7)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850993
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
102545 (Mouse (Murine), CMTM7)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Cloning Vector
Vector backbone:
pT7T3D-PacI
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4097900
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
112616 (Human, CMTM7)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094369
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
548578 (Xenopus tropicalis, CMTM7)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065466
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Species:
Human
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558671
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
NM_133978
Species:
Mouse (Murine)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558672
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7
Species:
Human
Synonyms:
CKLFSF7, im:7143001, si:dkey-11p23.3, AI481279, Cklfsf7, LNV, cklfsf7, cmtm7
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190279
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Species:
Human
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Insert length:
528 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751762
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
532269 (Cow (Bovine), CMTM7)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3861886
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
446371 (Xenopus laevis, CMTM7)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850994
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
112616 (Human, CMTM7)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094370
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
548578 (Xenopus tropicalis, CMTM7)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065467
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
Gene ID:
112616 (Human, CMTM7)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Insert length:
528 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5315444
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
NM_001252479,NP_001239408
Species:
Mouse (Murine)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Insert length:
405 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3296767
$200.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
NM_133978
Species:
Mouse (Murine)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3928672
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
NM_133978
Species:
Mouse (Murine)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3928662
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 7 (CMTM7)
NCBI Accession:
NM_133978
Species:
Mouse (Murine)
Synonyms:
CMTM7, cmtm7, Cmtm7, cmtm7.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3928668
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to CMTM7

  • CKLF like MARVEL transmembrane domain containing 7 (CMTM7)
  • CKLF-like MARVEL transmembrane domain containing 7 (cmtm7)
  • CKLF-like MARVEL transmembrane domain containing 7 (Cmtm7)
  • CKLF-like MARVEL transmembrane domain containing 7 L homeolog (cmtm7.L)
  • CKLF like MARVEL transmembrane domain containing 7 (Cmtm7)
  • AI481279
  • CKLFSF7
  • Cklfsf7
  • cklfsf7
  • cmtm7
  • im:7143001
  • LNV
  • si:dkey-11p23.3

Gene-IDs for different species

GENE IDSPECIES
112616 Homo sapiens
420666 Gallus gallus
559138 Danio rerio
102545 Mus musculus
501065 Rattus norvegicus
446371 Xenopus laevis
532269 Bos taurus
100734875 Cavia porcellus

Protein level used designations for CMTM7

  • CKLF-like MARVEL transmembrane domain-containing protein 7
  • chemokine-like factor super family 7
  • chemokine-like factor super family member 7 variant 2
  • chemokine-like factor superfamily 7
  • chemokine-like factor superfamily member 7
  • CKLF-like MARVEL transmembrane domain containing 7 L homeolog
Other products related to CMTM7 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com