CXCL12 (Chemokine (C-X-C Motif) Ligand 12, CXCL12)

Short Description: This gene encodes a stromal cell-derived alpha chemokine member of the intercrine family. This gene product and its receptor CXCR4 can activate lymphocytes and have been implicated in the metastasis of some cancers such as breast cancer. Mutations in this gene are associated with resistance to human immunodeficiency virus type 1 infections. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010].
More information related to gene CXCL12.
Products related to CXCL12 Gene:
245 Products
Data Quality
  • 1
  • 7
Type
  • 239
  • 6
Species
  • 73
  • 71
  • 67
  • 12
  • 12
Application
  • 177
  • 54
  • 22
  • 22
  • 2
Fusion tag
  • 69
  • 31
  • 29
  • 27
  • 17
Vector Backbone
  • 17
  • 17
  • 15
  • 10
  • 8
Vector
  • 129
  • 61
  • 28
  • 9
  • 8
Insert
  • 113
  • 86
  • 18
  • 10
  • 10
Oligo-Type
  • 4
  • 2
Resistance Gene
  • 126
  • 66
  • 40
  • 7
  • 2
Expression Type
  • 179
  • 76
  • 55
Selectable Marker
  • 57
  • 55
  • 26
Promoter
  • 81
  • 80
  • 36
  • 31
  • 10
Format
  • 130
  • 63
  • 35
  • 17

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
NCBI Accession:
NM_000609,NP_000600
Species:
Human
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Insert length:
282 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5397582
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
NCBI Accession:
NM_199168,NP_954637
Species:
Human
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Insert length:
270 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5397581
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
Gene ID:
6387 (Human, CXCL12)
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3464876
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
Gene ID:
399030 (Xenopus laevis, CXCL12)
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846490
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
Gene ID:
399030 (Xenopus laevis, CXCL12)
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846491
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
Gene ID:
24772 (Rat (Rattus), CXCL12)
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045507
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
Gene ID:
613811 (Cow (Bovine), CXCL12)
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066860
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
Gene ID:
548481 (Xenopus tropicalis, CXCL12)
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065372
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
NCBI Accession:
NM_000609
Species:
Human
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886707
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
NCBI Accession:
NM_021704
Species:
Mouse (Murine)
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559015
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
NCBI Accession:
NM_001032934
Species:
Rhesus Monkey
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559014
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
NCBI Accession:
NM_001033882
Species:
Rat (Rattus)
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559016
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
NCBI Accession:
NM_001128097
Species:
Dog (Canine)
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559013
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Chemokine (C-X-C Motif) Ligand 12
Species:
Human
Synonyms:
IRH, PBSF, SCYB12, SDF1, TLSF, TPAR1, Pbsf, Scyb12, Sdf1, Tlsf, Tpar1, sdf-1, sdf1, xSDF-1, SDF-1, cxcl12, sdf-1a, sdf1a, wu:fa55e10, wu:fc16h12, wu:fj84c02
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188527
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Chemokine (C-X-C Motif) Ligand 12
Species:
Mouse (Murine)
Synonyms:
IRH, PBSF, SCYB12, SDF1, TLSF, TPAR1, Pbsf, Scyb12, Sdf1, Tlsf, Tpar1, sdf-1, sdf1, xSDF-1, SDF-1, cxcl12, sdf-1a, sdf1a, wu:fa55e10, wu:fc16h12, wu:fj84c02
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193581
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
NCBI Accession:
NM_000609
Species:
Human
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Insert length:
270 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5739299
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
Gene ID:
6387 (Human, CXCL12)
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3464878
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
Gene ID:
399030 (Xenopus laevis, CXCL12)
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846489
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
Gene ID:
399030 (Xenopus laevis, CXCL12)
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846488
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-X-C Motif) Ligand 12 (CXCL12)
Gene ID:
24772 (Rat (Rattus), CXCL12)
Synonyms:
CXCL12, cxcl12, Cxcl12, cxcl12.L, cxcl12a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045508
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1
  • ...
  • ...

Synonyms and alternative names related to CXCL12

  • C-X-C motif chemokine ligand 12 (CXCL12)
  • C-X-C motif chemokine ligand 12 (cxcl12)
  • chemokine (C-X-C motif) ligand 12 (Cxcl12)
  • C-X-C motif chemokine ligand 12 (Cxcl12)
  • C-X-C motif chemokine ligand 12 L homeolog (cxcl12.L)
  • chemokine (C-X-C motif) ligand 12a (stromal cell-derived factor 1) (cxcl12a)
  • cxcl12
  • IRH
  • Pbsf
  • PBSF
  • SCYB12
  • Scyb12
  • sdf-1
  • SDF-1
  • sdf-1a
  • SDF1
  • Sdf1
  • sdf1
  • sdf1a
  • TLSF
  • Tlsf
  • Tpar1
  • TPAR1
  • wu:fa55e10
  • wu:fc16h12
  • wu:fj84c02
  • xSDF-1

Gene-IDs for different species

GENE IDSPECIES
6387 Homo sapiens
574334 Macaca mulatta
100173045 Pongo abelii
100304642 Ictalurus punctatus
20315 Mus musculus
24772 Rattus norvegicus
399030 Xenopus laevis
395180 Gallus gallus
449622 Canis lupus familiaris
494460 Sus scrofa
613811 Bos taurus
493806 Felis catus
100721137 Cavia porcellus
352944 Danio rerio

Protein level used designations for CXCL12

  • intercrine reduced in hepatomas
  • pre-B cell growth-stimulating factor
  • stromal cell-derived factor 1
  • chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)
  • chemokine CXCL12/SDF-1ALPHA
  • stromal cell-derived factor 1 isoform alpha
  • stromal cell-derived factor 1 isoform gamma
  • CXCL12
  • 12-O-tetradecanoylphorbol 13-acetate repressed protein 1
  • pre-B-cell growth-stimulating factor
  • thymic lymphoma cell-stimulating factor
  • SDF-1 gamma
  • Stromal cell-derived factor 1
  • stromal cell-derived factor-1 gamma
  • C-X-C motif chemokine 12
  • stromal-derived factor 1
  • chemokine ligand 12b
  • stromal cell derived factor 1
  • stromal cell-derived factor-1 beta
  • CXC chemokine
  • CXCL12 chemokine
  • chemokine ligand 12
  • unm t30516
  • unm_t30516
Other products related to CXCL12 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com