Cytochrome C (Cytochrome C, Somatic, CYCS)

Short Description: This gene encodes a small heme protein that functions as a central component of the electron transport chain in mitochondria. The encoded protein associates with the inner membrane of the mitochondrion where it accepts electrons from cytochrome b and transfers them to the cytochrome oxidase complex. This protein is also involved in initiation of apoptosis. Mutations in this gene are associated with autosomal dominant nonsyndromic thrombocytopenia. Numerous processed pseudogenes of this gene are found throughout the human genome.[provided by RefSeq, Jul 2010].
More information related to gene Cytochrome C.
Products related to Cytochrome C Gene:
236 Products
Type
  • 228
  • 8
Species
  • 105
  • 48
  • 47
  • 14
  • 14
Application
  • 132
  • 85
  • 27
  • 16
  • 2
Fusion tag
  • 105
  • 22
  • 16
  • 14
  • 11
Vector Backbone
  • 40
  • 8
  • 6
  • 6
  • 6
Vector
  • 106
  • 52
  • 36
  • 16
  • 9
Insert
  • 97
  • 94
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 2
Resistance Gene
  • 105
  • 58
  • 57
  • 8
  • 2
Expression Type
  • 106
  • 65
  • 54
Selectable Marker
  • 65
  • 28
  • 26
  • 1
Promoter
  • 84
  • 35
  • 31
  • 17
  • 8
Format
  • 109
  • 69
  • 36
  • 22

Type:
ORF
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Species:
Human
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Insert length:
318 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5733722
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Species:
Human
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Insert length:
318 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5733723
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Cytochrome C, Somatic (CYCS)
NCBI Accession:
NM_018947,NP_061820
Species:
Human
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Insert length:
318 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5379325
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
415158 (Zebrafish (Danio rerio), CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041807
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
54205 (Human, CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3469734
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
394490 (Xenopus tropicalis, CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3881306
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
444530 (Xenopus laevis, CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850618
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
510767 (Cow (Bovine), CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3857077
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
25309 (Rat (Rattus), CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045759
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
25309 (Rat (Rattus), CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045758
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
54205 (Human, CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037716
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
54205 (Human, CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037717
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
54205 (Human, CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037718
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
54205 (Human, CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037719
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
54205 (Human, CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037720
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
54205 (Human, CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037721
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
54205 (Human, CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037722
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
54205 (Human, CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037723
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
54205 (Human, CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037724
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C, Somatic (CYCS)
Gene ID:
54205 (Human, CYCS)
Synonyms:
CYCS, cycs.S, cycs, Cycs, Cyt-c-p, cycsb, LOC100724240, CYC, LOC100847700, LOC101107954, LOC106829744, LOC106992390
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037725
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1
  • ...

Synonyms and alternative names related to Cytochrome C

  • cytochrome c, somatic (CYCS)
  • cytochrome c, somatic S homeolog (cycs.S)
  • cytochrome c, somatic (cycs)
  • cytochrome c, somatic (Cycs)
  • Cytochrome c proximal (Cyt-c-p)
  • cytochrome c, somatic b (cycsb)
  • cytochrome c-like (LOC100724240)
  • cytochrome c (CYC)
  • cytochrome c (LOC100847700)
  • cytochrome c (LOC101107954)
  • cytochrome c (LOC106829744)
  • cytochrome c (LOC106992390)
  • CG17903
  • CYC
  • cyc
  • CYCS
  • CYCSA
  • cyct
  • cyt-c-p
  • Cyt-c2
  • cyt-c2
  • cyt.c
  • cyt c
  • Cytc
  • Cyt c
  • Cyt C
  • cytc
  • CytC-2
  • cyt c-p
  • Cytc-p
  • cytochrome c
  • DC4
  • dc4
  • DMc01
  • Dmel\\CG17903
  • HCS
  • hcs
  • pDMc01
  • THC4
  • wu:fk52b01
  • zgc:86706

Gene-IDs for different species

GENE IDSPECIES
54205 Homo sapiens
444530 Xenopus laevis
475258 Canis lupus familiaris
420624 Gallus gallus
394490 Xenopus (Silurana) tropicalis
100170131 Sus scrofa
744779 Pan troglodytes
100053958 Equus caballus
100233210 Taeniopygia guttata
100171479 Pongo abelii
510767 Bos taurus
13063 Mus musculus
25309 Rattus norvegicus
34996 Drosophila melanogaster
415158 Danio rerio
100724240 Cavia porcellus
100549365 Meleagris gallopavo
100847700 Bos taurus
101107954
106829744 Equus asinus
106992390 Macaca mulatta

Protein level used designations for Cytochrome C

  • cytochrome c
  • cytochrome c, testis-specific
  • cytochrome c, testis
  • somatic cytochrome c
  • cytochrome c, somatic
  • Cytochrome C, expressed in somatic tissues
  • CG17903-PA
  • Cyt-c-p-PA
  • Cytochrome-c-proximal
  • cytochrome c DC4
  • cytochrome c proximal
  • cytochrome-c-p
  • fk52b01
  • Cytochrome c
  • cytochrome c, somatic pseudogene
Other products related to Cytochrome C such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com