EEF1E1 (Eukaryotic Translation Elongation Factor 1 epsilon 1, EEF1E1)

Short Description: This gene encodes a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, the encoded protein is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. However, its mouse homolog has been shown to translocate to the nucleus in response to DNA damage, and it plays a positive role in ATM/ATR-mediated p53 activation. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream MUTED (muted homolog) gene. An EEF1E1-related pseudogene has been identified on chromosome 2. [provided by RefSeq, Dec 2010].
More information related to gene EEF1E1.
Products related to EEF1E1 Gene:
143 Products
  • 137
  • 6
  • 61
  • 44
  • 28
  • 6
  • 2
  • 87
  • 34
  • 25
  • 16
  • 1
Fusion tag
  • 51
  • 18
  • 13
  • 13
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
  • 61
  • 39
  • 12
  • 11
  • 9
  • 55
  • 46
  • 20
  • 8
  • 6
  • 5
  • 1
Resistance Gene
  • 61
  • 46
  • 26
  • 4
  • 2
Expression Type
  • 98
  • 50
  • 26
Selectable Marker
  • 31
  • 26
  • 26
  • 40
  • 37
  • 30
  • 13
  • 8
  • 70
  • 27
  • 24
  • 22

Protein Expression
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
NCBI Accession:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Insert length:
525 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5440694
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Protein Expression
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
NCBI Accession:
Gene ID:
9521 (Human, EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Insert length:
525 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4919881
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
ISO 9001:2008

Protein Expression
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
NCBI Accession:
Gene ID:
9521 (Human, EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Insert length:
420 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4930264
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
100038230 (Xenopus tropicalis, EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3872186
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
617105 (Cow (Bovine), EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3867313
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
495305 (Xenopus laevis, EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3853392
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
66143 (Mouse (Murine), EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4038376
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
291057 (Rat (Rattus), EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4050057
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
9521 (Human, EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4036053
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
100038230 (Xenopus tropicalis, EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4025731
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
100038230 (Xenopus tropicalis, EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4025732
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3559544
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
NCBI Accession:
Mouse (Murine)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3559545
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
Eukaryotic Translation Elongation Factor 1 epsilon 1
p18, AIMP3, P18, 1110003A02Rik
-20 °C
Catalog No. ABIN3190995
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Insert length:
525 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5752471
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression, Cloning
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
100038230 (Xenopus tropicalis, EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3872185
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
617105 (Cow (Bovine), EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3867315
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
495305 (Xenopus laevis, EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3853391
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
66143 (Mouse (Murine), EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4038375
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
291057 (Rat (Rattus), EEF1E1)
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4050056
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to EEF1E1

  • eukaryotic translation elongation factor 1 epsilon 1 (EEF1E1)
  • eukaryotic translation elongation factor 1 epsilon 1 L homeolog (eef1e1.L)
  • eukaryotic translation elongation factor 1 epsilon 1 (eef1e1)
  • eukaryotic translation elongation factor 1 epsilon 1 (Eef1e1)
  • 1110003A02Rik
  • AIMP3
  • p18
  • P18

Gene-IDs for different species

420865 Gallus gallus
462423 Pan troglodytes
478717 Canis lupus familiaris
495305 Xenopus laevis
617105 Bos taurus
695426 Macaca mulatta
100038230 Xenopus (Silurana) tropicalis
100135689 Ovis aries
9521 Homo sapiens
66143 Mus musculus
291057 Rattus norvegicus
100689310 Cricetulus griseus

Protein level used designations for EEF1E1

  • eukaryotic translation elongation factor 1 epsilon 1
  • eukaryotic translation elongation factor 1 epsilon-1
  • ARS-interacting multifunctional protein 3
  • aminoacyl tRNA synthetase complex-interacting multifunctional protein 3
  • multisynthase complex auxiliary component p18
  • p18 component of aminoacyl-tRNA synthetase complex
  • elongation factor p18
  • multisynthetase complex auxiliary component p18
  • Elongation factor p18
  • Multisynthase complex auxiliary component p18
Other products related to EEF1E1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website