EEF1E1 (Eukaryotic Translation Elongation Factor 1 epsilon 1, EEF1E1)

Short Description: This gene encodes a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, the encoded protein is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. However, its mouse homolog has been shown to translocate to the nucleus in response to DNA damage, and it plays a positive role in ATM/ATR-mediated p53 activation. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream MUTED (muted homolog) gene. An EEF1E1-related pseudogene has been identified on chromosome 2. [provided by RefSeq, Dec 2010].
More information related to gene EEF1E1.
Products related to EEF1E1 Gene:
143 Products
Type
  • 137
  • 6
Species
  • 61
  • 44
  • 28
  • 6
  • 2
Application
  • 87
  • 34
  • 25
  • 16
  • 1
Fusion tag
  • 51
  • 18
  • 13
  • 13
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 61
  • 39
  • 12
  • 11
  • 9
Insert
  • 55
  • 46
  • 20
  • 8
  • 6
Oligo-Type
  • 5
  • 1
Resistance Gene
  • 61
  • 46
  • 26
  • 4
  • 2
Expression Type
  • 98
  • 50
  • 26
Selectable Marker
  • 31
  • 26
  • 26
Promoter
  • 40
  • 37
  • 30
  • 13
  • 8
Format
  • 70
  • 27
  • 24
  • 22
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Species:
Human
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5752471
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
NCBI Accession:
NM_004280,NP_004271
Species:
Human
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Insert length:
525 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5440694
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
NCBI Accession:
NM_001135650
Gene ID:
9521 (Human, EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Insert length:
420 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4930264
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
NCBI Accession:
NM_004280
Gene ID:
9521 (Human, EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Insert length:
525 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4919881
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
495305 (Xenopus laevis, EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3853392
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
617105 (Cow (Bovine), EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3867313
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
100038230 (Xenopus tropicalis, EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872186
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
100038230 (Xenopus tropicalis, EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4025731
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
100038230 (Xenopus tropicalis, EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4025732
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
9521 (Human, EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4036053
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
291057 (Rat (Rattus), EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4050057
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
66143 (Mouse (Murine), EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4038376
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Species:
Human
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559544
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
NCBI Accession:
NM_025380
Species:
Mouse (Murine)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559545
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1
Species:
Human
Synonyms:
p18, AIMP3, P18, 1110003A02Rik
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190995
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
66143 (Mouse (Murine), EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4038375
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
100038230 (Xenopus tropicalis, EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4025729
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
100038230 (Xenopus tropicalis, EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4025730
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
9521 (Human, EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4036054
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Eukaryotic Translation Elongation Factor 1 epsilon 1 (EEF1E1)
Gene ID:
100038230 (Xenopus tropicalis, EEF1E1)
Synonyms:
EEF1E1, eef1e1.L, eef1e1, Eef1e1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872185
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to EEF1E1

  • eukaryotic translation elongation factor 1 epsilon 1 (EEF1E1)
  • eukaryotic translation elongation factor 1 epsilon 1 L homeolog (eef1e1.L)
  • eukaryotic translation elongation factor 1 epsilon 1 (eef1e1)
  • eukaryotic translation elongation factor 1 epsilon 1 (Eef1e1)
  • 1110003A02Rik
  • AIMP3
  • p18
  • P18

Gene-IDs for different species

GENE IDSPECIES
420865 Gallus gallus
462423 Pan troglodytes
478717 Canis lupus familiaris
495305 Xenopus laevis
617105 Bos taurus
695426 Macaca mulatta
100038230 Xenopus (Silurana) tropicalis
100135689 Ovis aries
9521 Homo sapiens
66143 Mus musculus
291057 Rattus norvegicus
100689310 Cricetulus griseus

Protein level used designations for EEF1E1

  • eukaryotic translation elongation factor 1 epsilon 1
  • eukaryotic translation elongation factor 1 epsilon-1
  • ARS-interacting multifunctional protein 3
  • aminoacyl tRNA synthetase complex-interacting multifunctional protein 3
  • multisynthase complex auxiliary component p18
  • p18 component of aminoacyl-tRNA synthetase complex
  • elongation factor p18
  • multisynthetase complex auxiliary component p18
  • Elongation factor p18
  • Multisynthase complex auxiliary component p18
Other products related to EEF1E1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com