ELK1 (ELK1, Member of ETS Oncogene Family, ELK1)

Short Description: This gene is a member of the Ets family of transcription factors and of the ternary complex factor (TCF) subfamily. Proteins of the TCF subfamily form a ternary complex by binding to the the serum response factor and the serum response element in the promoter of the c-fos proto-oncogene. The protein encoded by this gene is a nuclear target for the ras-raf-MAPK signaling cascade. This gene produces multiple isoforms by using alternative translational start codons and by alternative splicing. Related pseudogenes have been identified on chromosomes 7 and 14. [provided by RefSeq, Mar 2012].
More information related to gene ELK1.
Products related to ELK1 Gene:
95 Products
Data Quality
  • 1
Type
  • 90
  • 5
Species
  • 44
  • 26
  • 25
Application
  • 50
  • 25
  • 20
  • 12
Fusion tag
  • 27
  • 18
  • 13
  • 9
  • 8
Vector Backbone
  • 7
  • 7
  • 6
  • 5
  • 4
Vector
  • 33
  • 30
  • 12
  • 9
  • 5
Insert
  • 31
  • 27
  • 20
  • 6
  • 4
Oligo-Type
  • 5
Resistance Gene
  • 34
  • 32
  • 20
  • 4
  • 2
Expression Type
  • 89
  • 47
Selectable Marker
  • 24
  • 24
Promoter
  • 37
  • 26
  • 14
  • 7
  • 6
Format
  • 42
  • 27
  • 18
  • 8

Type:
ORF
Application:
Cloning
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
Species:
Human
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
1287 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5749851
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
Gene ID:
2002 (Human, ELK1)
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803844
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
Gene ID:
13712 (Mouse (Murine), ELK1)
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096457
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
Gene ID:
2002 (Human, ELK1)
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803845
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
Gene ID:
13712 (Mouse (Murine), ELK1)
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096456
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
Gene ID:
2002 (Human, ELK1)
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
1287 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5320756
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
Species:
Human
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
1287 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4701640
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
Species:
Human
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
1287 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4761513
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
Species:
Human
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
1287 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4766806
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
Species:
Human
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
1287 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4830769
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
Species:
Human
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
1287 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4436233
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
Species:
Human
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
1287 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4475138
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
NCBI Accession:
NM_005229,NP_005220
Species:
Human
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
2800 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Patki, Chari, Sivakumaran, Gonit, Trumbly, Ratnam: "The ETS domain transcription factor ELK1 directs a critical component of growth signaling by the androgen receptor in prostate cancer cells." in: The Journal of biological chemistry, Vol. 288, Issue 16, pp. 11047-65, 2013 (Pubmed)
  • Zhang, Zhang, Gao, Wang, Liu: "Regulation of the microRNA 200b (miRNA-200b) by transcriptional regulators PEA3 and ELK-1 protein affects expression of Pin1 protein to control anoikis." in: The Journal of biological chemistry, Vol. 288, Issue 45, pp. 32742-52, 2013 (Pubmed)
  • Reichman, Kalathur, Lambard, Aït-Ali, Yang, Lardenois, Ripp, Poch, Zack, Sahel, Léveillard: "The homeobox gene CHX10/VSX2 regulates RdCVF promoter activity in the inner retina." in: Human molecular genetics, Vol. 19, Issue 2, pp. 250-61, 2009 (Pubmed)
  • Aprelikova, Wood, Tackett, Chandramouli, Barrett: "Role of ETS transcription factors in the hypoxia-inducible factor-2 target gene selection." in: Cancer research, Vol. 66, Issue 11, pp. 5641-7, 2006 (Pubmed)
Catalog No. ABIN3377880
$310.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
NCBI Accession:
NM_005229
Species:
Human
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ELK1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5136726
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
NCBI Accession:
NM_001108059
Species:
Rat (Rattus)
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Elk1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5136728
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
NCBI Accession:
NM_005229,NP_005220
Species:
Human
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
1287 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5432274
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
NCBI Accession:
NM_001114123,NP_001107595
Species:
Human
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
1287 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5432275
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
NCBI Accession:
NM_001257168,NP_001244097
Species:
Human
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
288 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5432276
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 71 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
NCBI Accession:
NM_001108059,NP_001101529
Species:
Rat (Rattus)
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
1284 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5432277
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
NCBI Accession:
NM_001108059,NP_001101529
Species:
Rat (Rattus)
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
1284 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3291510
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ELK1

  • ELK1, ETS transcription factor (ELK1)
  • ELK1, member of ETS oncogene family (Elk1)
  • ELK1, ETS transcription factor (Elk1)
  • ETS domain-containing protein Elk-1 (Tsp_02690)
  • ELK1, member of ETS oncogene family (elk1)
  • ELK1, member of ETS oncogene family S homeolog (elk1.S)
  • Elk-1
  • elk-1
  • elk1
  • Xelk
  • Xelk-1

Gene-IDs for different species

GENE IDSPECIES
2002 Homo sapiens
13712 Mus musculus
314436 Rattus norvegicus
10899147 Trichinella spiralis
567895 Danio rerio
491860 Canis lupus familiaris
786886 Bos taurus
100522002 Sus scrofa
100727907 Cavia porcellus
100190767 Xenopus laevis

Protein level used designations for ELK1

  • ETS domain-containing protein Elk-1
  • ETS-like gene 1
  • tyrosine kinase (ELK1) oncogene
  • ELK1, member of ETS oncogene family S homeolog
  • ternary complex factor Elk-1
Other products related to ELK1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com