FABP4 (Fatty Acid Binding Protein 4, Adipocyte, FABP4)

Short Description: FABP4 encodes the fatty acid binding protein found in adipocytes. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Jul 2008].
More information related to gene FABP4.
Products related to FABP4 Gene:
129 Products
Type
  • 122
  • 7
Species
  • 52
  • 48
  • 26
  • 2
  • 1
Application
  • 77
  • 27
  • 25
  • 18
  • 2
Fusion tag
  • 46
  • 14
  • 13
  • 9
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 5
  • 5
Vector
  • 54
  • 36
  • 12
  • 9
  • 6
Insert
  • 47
  • 37
  • 20
  • 8
  • 8
Oligo-Type
  • 5
  • 2
Resistance Gene
  • 56
  • 42
  • 18
  • 6
  • 2
Expression Type
  • 88
  • 51
  • 26
  • 2
Selectable Marker
  • 26
  • 26
  • 25
  • 1
Promoter
  • 37
  • 32
  • 28
  • 13
  • 8
Format
  • 64
  • 27
  • 22
  • 16

Type:
ORF
Application:
Protein Expression
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
NM_001442,NP_001433
Species:
Human
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Insert length:
399 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5430475
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
NM_001442
Gene ID:
2167 (Human, FABP4)
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Insert length:
399 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4939618
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
11770 (Mouse (Murine), FABP4)
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3807627
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
11770 (Mouse (Murine), FABP4)
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3462588
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
100124818 (Xenopus tropicalis, FABP4)
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031709
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
2167 (Human, FABP4)
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034658
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
734299 (Xenopus laevis, FABP4)
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Cloning Vector
Vector backbone:
pBluescript SK-
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3468829
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
NM_024406
Species:
Mouse (Murine)
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3888051
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
NM_001442
Species:
Human
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886841
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Fatty Acid Binding Protein 4, Adipocyte
Species:
Mouse (Murine)
Synonyms:
A-FABP, AFABP, ALBP, aP2, LOC100223994, FABP, AP2, FABP3, FABP4, MGC84940, fabp4, 422/aP2, ALBP/Ap2, Ap2, Lbpl, Albp
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194188
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Fatty Acid Binding Protein 4, Adipocyte
Species:
Human
Synonyms:
A-FABP, AFABP, ALBP, aP2, LOC100223994, FABP, AP2, FABP3, FABP4, MGC84940, fabp4, 422/aP2, ALBP/Ap2, Ap2, Lbpl, Albp
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189972
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Species:
Human
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Insert length:
399 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5749377
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
11770 (Mouse (Murine), FABP4)
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3807629
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
11770 (Mouse (Murine), FABP4)
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3462589
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
100124818 (Xenopus tropicalis, FABP4)
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031708
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
2167 (Human, FABP4)
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034657
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
2167 (Human, FABP4)
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Insert length:
399 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5315265
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
NM_001442
Species:
Human
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948167

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3895738
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
NM_001442
Species:
Human
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3895733
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
NM_001442
Species:
Human
Synonyms:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3895734
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to FABP4

  • fatty acid binding protein 4 (FABP4)
  • fatty acid-binding protein, adipocyte (LOC100223994)
  • fatty acid binding protein 4, adipocyte (FABP4)
  • fatty acid binding protein 4, adipocyte L homeolog (fabp4.L)
  • fatty acid binding protein 4, adipocyte (fabp4)
  • Fatty acid-binding protein, adipocyte (fabp4)
  • fatty acid binding protein 4, adipocyte (Fabp4)
  • fatty acid binding protein 4 (Fabp4)
  • fatty acid-binding protein, adipocyte (LOC100732353)
  • adipocyte fatty acid-binding protein (LOC100861279)
  • fatty acid-binding protein, adipocyte (LOC100057425)
  • adipocyte fatty acid binding protein (LOC395224)
  • 422/aP2
  • A-FABP
  • AFABP
  • ALBP
  • Albp
  • ALBP/Ap2
  • aP2
  • AP2
  • Ap2
  • FABP
  • FABP3
  • FABP4
  • fabp4
  • Lbpl
  • LOC100223994
  • MGC84940

Gene-IDs for different species

GENE IDSPECIES
2167 Homo sapiens
100223994 Taeniopygia guttata
281759 Bos taurus
374165 Gallus gallus
399533 Sus scrofa
464255 Pan troglodytes
701365 Macaca mulatta
734299 Xenopus laevis
100009416 Oryctolagus cuniculus
100124818 Xenopus (Silurana) tropicalis
100137067 Ovis aries
100196174 Salmo salar
11770 Mus musculus
79451 Rattus norvegicus
100732353 Cavia porcellus
100861279 Capra hircus
608476 Canis lupus familiaris
100057425 Equus caballus
395224

Protein level used designations for FABP4

  • adipocyte lipid-binding protein
  • adipocyte-type fatty acid-binding protein
  • fatty acid-binding protein 4
  • fatty acid-binding protein, adipocyte
  • fatty acid binding protein 4, adipocyte
  • A-FABP
  • AFABP
  • ALBP
  • adipocyte fatty acid binding protein
  • adipocyte-type fatty acid binding protein
  • Adipocyte-type fatty acid-binding protein
  • adipocyte fatty acid-binding protein 4
  • Fatty acid-binding protein, adipocyte
  • 3T3-L1 lipid-binding protein
  • P15
  • P2 adipocyte protein
  • adipocyte protein aP2
  • myelin P2 protein homolog
  • protein 422
Other products related to FABP4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com