FABP4 (Fatty Acid Binding Protein 4, Adipocyte, FABP4)

Short Description: FABP4 encodes the fatty acid binding protein found in adipocytes. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Jul 2008].
More information related to gene FABP4.
Products related to FABP4 Gene:
129 Products
  • 122
  • 7
  • 52
  • 48
  • 26
  • 2
  • 1
  • 77
  • 27
  • 25
  • 18
  • 2
Fusion tag
  • 46
  • 14
  • 13
  • 9
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 5
  • 5
  • 54
  • 36
  • 12
  • 9
  • 6
  • 47
  • 37
  • 20
  • 8
  • 8
  • 5
  • 2
Resistance Gene
  • 56
  • 42
  • 18
  • 6
  • 2
Expression Type
  • 88
  • 51
  • 26
  • 2
Selectable Marker
  • 26
  • 26
  • 25
  • 1
  • 37
  • 32
  • 28
  • 13
  • 8
  • 64
  • 27
  • 22
  • 16

Fatty Acid Binding Protein 4, Adipocyte (FABP4)
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Insert length:
399 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5749377
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Insert length:
399 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5430475
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Protein Expression
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
Gene ID:
2167 (Human, FABP4)
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Insert length:
399 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4939618
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Protein Expression, Cloning
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
11770 (Mouse (Murine), FABP4)
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3462588
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
734299 (Xenopus laevis, FABP4)
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Cloning Vector
Vector backbone:
pBluescript SK-
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3468829
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
11770 (Mouse (Murine), FABP4)
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3807627
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
100124818 (Xenopus tropicalis, FABP4)
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4031709
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
2167 (Human, FABP4)
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4034658
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47
  • RV-M
Catalog No. ABIN3886841
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
Mouse (Murine)
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Catalog No. ABIN3888051
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
Fatty Acid Binding Protein 4, Adipocyte
Mouse (Murine)
A-FABP, AFABP, ALBP, aP2, LOC100223994, FABP, AP2, FABP3, FABP4, MGC84940, fabp4, 422/aP2, ALBP/Ap2, Ap2, Lbpl, Albp
-20 °C
Catalog No. ABIN3194188
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
Fatty Acid Binding Protein 4, Adipocyte
A-FABP, AFABP, ALBP, aP2, LOC100223994, FABP, AP2, FABP3, FABP4, MGC84940, fabp4, 422/aP2, ALBP/Ap2, Ap2, Lbpl, Albp
-20 °C
Catalog No. ABIN3189972
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Protein Expression, Cloning
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
11770 (Mouse (Murine), FABP4)
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3462589
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
11770 (Mouse (Murine), FABP4)
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3807629
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
100124818 (Xenopus tropicalis, FABP4)
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4031708
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
2167 (Human, FABP4)
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4034657
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Fatty Acid Binding Protein 4, Adipocyte (FABP4)
Gene ID:
2167 (Human, FABP4)
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Insert length:
399 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5315265
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3895730
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Protein Expression
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
HA tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3895732
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Fatty Acid Binding Protein 4, Adipocyte (FABP4)
NCBI Accession:
FABP4, LOC100223994, fabp4.L, fabp4, Fabp4, LOC100732353, LOC100861279, LOC100057425, LOC395224
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
His tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3895733
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to FABP4

  • fatty acid binding protein 4 (FABP4)
  • fatty acid-binding protein, adipocyte (LOC100223994)
  • fatty acid binding protein 4, adipocyte (FABP4)
  • fatty acid binding protein 4, adipocyte L homeolog (fabp4.L)
  • fatty acid binding protein 4, adipocyte (fabp4)
  • Fatty acid-binding protein, adipocyte (fabp4)
  • fatty acid binding protein 4, adipocyte (Fabp4)
  • fatty acid binding protein 4 (Fabp4)
  • fatty acid-binding protein, adipocyte (LOC100732353)
  • adipocyte fatty acid-binding protein (LOC100861279)
  • fatty acid-binding protein, adipocyte (LOC100057425)
  • adipocyte fatty acid binding protein (LOC395224)
  • 422/aP2
  • A-FABP
  • ALBP
  • Albp
  • ALBP/Ap2
  • aP2
  • AP2
  • Ap2
  • FABP
  • FABP3
  • FABP4
  • fabp4
  • Lbpl
  • LOC100223994
  • MGC84940

Gene-IDs for different species

2167 Homo sapiens
100223994 Taeniopygia guttata
281759 Bos taurus
374165 Gallus gallus
399533 Sus scrofa
464255 Pan troglodytes
701365 Macaca mulatta
734299 Xenopus laevis
100009416 Oryctolagus cuniculus
100124818 Xenopus (Silurana) tropicalis
100137067 Ovis aries
100196174 Salmo salar
11770 Mus musculus
79451 Rattus norvegicus
100732353 Cavia porcellus
100861279 Capra hircus
608476 Canis lupus familiaris
100057425 Equus caballus

Protein level used designations for FABP4

  • adipocyte lipid-binding protein
  • adipocyte-type fatty acid-binding protein
  • fatty acid-binding protein 4
  • fatty acid-binding protein, adipocyte
  • fatty acid binding protein 4, adipocyte
  • A-FABP
  • ALBP
  • adipocyte fatty acid binding protein
  • adipocyte-type fatty acid binding protein
  • Adipocyte-type fatty acid-binding protein
  • adipocyte fatty acid-binding protein 4
  • Fatty acid-binding protein, adipocyte
  • 3T3-L1 lipid-binding protein
  • P15
  • P2 adipocyte protein
  • adipocyte protein aP2
  • myelin P2 protein homolog
  • protein 422
Other products related to FABP4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com