Factor VIII (Coagulation Factor VIII, F8)

Short Description: This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation\; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder. [provided by RefSeq, Jul 2008].
More information related to gene Factor VIII.
Products related to Factor VIII Gene:
106 Products
Data Quality
  • 1
Type
  • 101
  • 5
Species
  • 48
  • 34
  • 22
  • 2
Application
  • 51
  • 28
  • 25
  • 16
Fusion tag
  • 40
  • 12
  • 11
  • 8
  • 7
Vector Backbone
  • 7
  • 6
  • 6
  • 6
  • 5
Vector
  • 37
  • 27
  • 16
  • 9
  • 9
Insert
  • 46
  • 20
  • 19
  • 8
  • 6
Oligo-Type
  • 5
Resistance Gene
  • 50
  • 34
  • 9
  • 8
  • 2
Expression Type
  • 94
  • 57
Selectable Marker
  • 34
  • 26
  • 4
  • 1
Promoter
  • 30
  • 30
  • 18
  • 9
  • 8
Format
  • 39
  • 38
  • 16
  • 13

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor VIII (F8)
Gene ID:
14069 (Mouse (Murine), F8)
Synonyms:
f7i, F8
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996677
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor VIII (F8)
Gene ID:
14069 (Mouse (Murine), F8)
Synonyms:
f7i, F8
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996678
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Coagulation Factor VIII (F8)
Species:
Human
Synonyms:
f7i, F8
Insert length:
651 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5722623
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor VIII (F8)
Gene ID:
14069 (Mouse (Murine), F8)
Synonyms:
f7i, F8
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996680
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor VIII (F8)
Gene ID:
14069 (Mouse (Murine), F8)
Synonyms:
f7i, F8
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996679
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Coagulation Factor VIII (F8)
Gene ID:
2157 (Human, F8)
Synonyms:
f7i, F8
Insert length:
651 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5311785
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Coagulation Factor VIII (F8)
Gene ID:
2157 (Human, F8)
Synonyms:
f7i, F8
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3396450
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Coagulation Factor VIII (F8)
Gene ID:
2157 (Human, F8)
Synonyms:
f7i, F8
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3417329
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Coagulation Factor VIII (F8)
NCBI Accession:
NM_019863,NP_063916
Species:
Human
Synonyms:
f7i, F8
Insert length:
2560 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3383963
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Coagulation Factor VIII (F8)
NCBI Accession:
NM_019863,NP_063916
Species:
Human
Synonyms:
f7i, F8
Insert length:
651 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5344111
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Coagulation Factor VIII
Species:
Mouse (Murine)
Synonyms:
fb61d02, wu:fb61d02, Cf-8, Cf8, FVIII, AHF, DXS1253E, F8B, F8C, HEMA
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • F8 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3350291
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Coagulation Factor VIII
Species:
Rat (Rattus)
Synonyms:
fb61d02, wu:fb61d02, Cf-8, Cf8, FVIII, AHF, DXS1253E, F8B, F8C, HEMA
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • F8 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3358324
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Coagulation Factor VIII
Species:
Human
Synonyms:
fb61d02, wu:fb61d02, Cf-8, Cf8, FVIII, AHF, DXS1253E, F8B, F8C, HEMA
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • F8 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3341289
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Coagulation Factor VIII (F8)
NCBI Accession:
NM_000132
Species:
Human
Synonyms:
f7i, F8
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of F8
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5086634
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Coagulation Factor VIII (F8)
NCBI Accession:
NM_007977
Species:
Mouse (Murine)
Synonyms:
f7i, F8
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of F8
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5086636
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Coagulation Factor VIII (F8)
NCBI Accession:
NM_183331
Species:
Rat (Rattus)
Synonyms:
f7i, F8
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of F8
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5086638
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Coagulation Factor VIII (F8)
Gene ID:
2157 (Human, F8)
Synonyms:
f7i, F8
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Resistance Gene:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Stable, Transient

Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3403130
$458.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Coagulation Factor VIII (F8)
Species:
Human
Synonyms:
f7i, F8
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5344109
$460.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Coagulation Factor VIII (F8)
Gene ID:
2157 (Human, F8)
Synonyms:
f7i, F8
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5051177

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5032232
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Coagulation Factor VIII
Gene ID:
14069 (Mouse (Murine), F8)
Synonyms:
fb61d02, wu:fb61d02, Cf-8, Cf8, FVIII, AHF, DXS1253E, F8B, F8C, HEMA
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5783054
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to Factor VIII

  • coagulation factor VIIi (f7i)
  • coagulation factor VIII (F8)
  • coagulation factor VIII, procoagulant component (F8)
  • AHF
  • Cf-8
  • Cf8
  • DXS1253E
  • F8B
  • F8C
  • fb61d02
  • FVIII
  • HEMA
  • wu:fb61d02

Gene-IDs for different species

GENE IDSPECIES
282671 Danio rerio
14069 Mus musculus
2157 Homo sapiens
397339 Sus scrofa
403875 Canis lupus familiaris
100271720 Bos taurus
100303761 Oryctolagus cuniculus
302470 Rattus norvegicus
100359363 Ovis aries
422199 Gallus gallus

Protein level used designations for Factor VIII

  • Factor VIII
  • procoagulant component
  • antihemophilic factor
  • coagulation factor VIII
  • coagulation factor VIIIc
  • factor VIII F8B
  • coagulation factor VIII, procoagulant component (hemophilia A)
  • factor VIII
  • coagulation co-factor
Other products related to Factor VIII such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com