FBXL17 (F-Box and Leucine-Rich Repeat Protein 17, FBXL17)

Short Description: Members of the F-box protein family, such as FBXL17, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1\; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008].
More information related to gene FBXL17.
Products related to FBXL17 Gene:
97 Products
Type
  • 93
  • 4
Species
  • 46
  • 25
  • 24
  • 2
Application
  • 49
  • 26
  • 20
  • 16
Fusion tag
  • 37
  • 14
  • 11
  • 9
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 35
  • 26
  • 12
  • 11
  • 6
Insert
  • 37
  • 24
  • 16
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 37
  • 34
  • 16
  • 6
  • 2
Expression Type
  • 82
  • 45
Selectable Marker
  • 33
  • 22
  • 1
Promoter
  • 31
  • 26
  • 12
  • 8
  • 8
Format
  • 31
  • 27
  • 22
  • 17

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
Gene ID:
100158323 (Xenopus laevis, FBXL17)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874122
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
Gene ID:
64839 (Human, FBXL17)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007144
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
Gene ID:
64839 (Human, FBXL17)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007145
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
Gene ID:
50758 (Mouse (Murine), FBXL17)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4005539
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
Gene ID:
50758 (Mouse (Murine), FBXL17)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4005540
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
Gene ID:
100158323 (Xenopus laevis, FBXL17)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874123
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
Gene ID:
64839 (Human, FBXL17)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007147
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
Gene ID:
64839 (Human, FBXL17)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007146
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
Gene ID:
50758 (Mouse (Murine), FBXL17)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4005538
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
Gene ID:
50758 (Mouse (Murine), FBXL17)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4005537
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
Gene ID:
64839 (Human, FBXL17)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Insert length:
912 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5323939
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
Gene ID:
64839 (Human, FBXL17)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3427866
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
Gene ID:
64839 (Human, FBXL17)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3415126
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
NCBI Accession:
NM_022824,NP_073735
Species:
Human
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Insert length:
912 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5424162
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
NCBI Accession:
NM_001108235,NP_001101705
Species:
Rat (Rattus)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Insert length:
912 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5424164
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
NCBI Accession:
NM_001108235,NP_001101705
Species:
Rat (Rattus)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Insert length:
912 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3292801
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
NCBI Accession:
NM_022824
Species:
Human
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FBXL17
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5131882
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
NCBI Accession:
NM_015794
Species:
Mouse (Murine)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Fbxl17
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5131884
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
F-Box and Leucine-Rich Repeat Protein 17 (FBXL17)
NCBI Accession:
NM_001108235
Species:
Rat (Rattus)
Synonyms:
FBXL17, Fbxl17, fbxl17.L, FBL17, LOC100726896
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Fbxl17
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5131886
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Application:
RNA Interference
Gene:
F-Box and Leucine-Rich Repeat Protein 17
Species:
Human
Synonyms:
FBXO13, Fbl17, Fbx13, 6330576B01Rik, AI452053, BB073797, C130023C01Rik, Fbxo13, FBXL17
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • FBXL17 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3288174
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to FBXL17

  • F-box and leucine rich repeat protein 17 (FBXL17)
  • F-box and leucine-rich repeat protein 17 (Fbxl17)
  • F-box and leucine-rich repeat protein 17 L homeolog (fbxl17.L)
  • RNI-like superfamily protein (FBL17)
  • F-box/LRR-repeat protein 17 (LOC100726896)
  • F-box and leucine-rich repeat protein 17 (FBXL17)
  • 6330576B01Rik
  • AI452053
  • BB073797
  • C130023C01Rik
  • Fbl17
  • Fbx13
  • FBXL17
  • FBXO13
  • Fbxo13

Gene-IDs for different species

GENE IDSPECIES
64839 Homo sapiens
50758 Mus musculus
316663 Rattus norvegicus
415615 Gallus gallus
461980 Pan troglodytes
608166 Canis lupus familiaris
100158323 Xenopus laevis
100348833 Oryctolagus cuniculus
100387200 Callithrix jacchus
100513341 Sus scrofa
824630 Arabidopsis thaliana
101106771 Ovis aries
100726896 Cavia porcellus
782335 Bos taurus

Protein level used designations for FBXL17

  • F-box only protein 13
  • F-box/LRR-repeat protein 17
  • F-box and leucine-rich repeat protein 17
  • F-box/LRR-repeat protein 17-like
  • f-box/LRR-repeat protein 17-like
Other products related to FBXL17 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com