FBXW4 (F-Box and WD Repeat Domain Containing 4, FBXW4)

Short Description: This gene is a member of the F-box/WD-40 gene family, which recruit specific target proteins through their WD-40 protein-protein binding domains for ubiquitin mediated degradation. In mouse, a highly similar protein is thought to be responsible for maintaining the apical ectodermal ridge of developing limb buds\; disruption of the mouse gene results in the absence of central digits, underdeveloped or absent metacarpal/metatarsal bones and syndactyly. This phenotype is remarkably similar to split hand-split foot malformation in humans, a clinically heterogeneous condition with a variety of modes of transmission. An autosomal recessive form has been mapped to the chromosomal region where this gene is located, and complex rearrangements involving duplications of this gene and others have been associated with the condition. A pseudogene of this locus has been mapped to one of the introns of the BCR gene on chromosome 22. [provided by RefSeq, Jul 2008].
More information related to gene FBXW4.
Products related to FBXW4 Gene:
  • 87
  • 2
  • 34
  • 26
  • 25
  • 2
  • 1
  • 49
  • 22
  • 20
  • 16
Fusion tag
  • 30
  • 13
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
  • 36
  • 25
  • 12
  • 9
  • 3
  • 32
  • 21
  • 18
  • 8
  • 6
  • 2
Resistance Gene
  • 34
  • 30
  • 18
  • 5
  • 2
Expression Type
  • 85
  • 46
Selectable Marker
  • 26
  • 20
  • 1
  • 28
  • 27
  • 13
  • 11
  • 8
  • 28
  • 27
  • 22
  • 12
89 Products

F-Box and WD Repeat Domain Containing 4 (FBXW4)
fbxw4, FBXW4, Fbxw4
Insert length:
879 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5750066
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression, Cloning
F-Box and WD Repeat Domain Containing 4 (FBXW4)
Gene ID:
58035 (Zebrafish (Danio rerio), FBXW4)
fbxw4, FBXW4, Fbxw4
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3875925
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
F-Box and WD Repeat Domain Containing 4 (FBXW4)
Gene ID:
58035 (Zebrafish (Danio rerio), FBXW4)
fbxw4, FBXW4, Fbxw4
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3818333
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
F-Box and WD Repeat Domain Containing 4 (FBXW4)
Gene ID:
100037117 (Xenopus laevis, FBXW4)
fbxw4, FBXW4, Fbxw4
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3984819
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
F-Box and WD Repeat Domain Containing 4 (FBXW4)
Gene ID:
6468 (Human, FBXW4)
fbxw4, FBXW4, Fbxw4
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3805357
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
F-Box and WD Repeat Domain Containing 4 (FBXW4)
Gene ID:
30838 (Mouse, FBXW4)
fbxw4, FBXW4, Fbxw4
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3813790
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
F-Box and WD Repeat Domain Containing 4 (FBXW4)
Gene ID:
513977 (Cow, FBXW4)
fbxw4, FBXW4, Fbxw4
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4062754
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

F-Box and WD Repeat Domain Containing 4 (FBXW4)
Gene ID:
6468 (Human, FBXW4)
fbxw4, FBXW4, Fbxw4
Insert length:
879 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5316103
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

F-Box and WD Repeat Domain Containing 4 (FBXW4)
fbxw4, FBXW4, Fbxw4
Insert length:
879 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4702348
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

F-Box and WD Repeat Domain Containing 4 (FBXW4)
fbxw4, FBXW4, Fbxw4
Insert length:
879 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4831478
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

F-Box and WD Repeat Domain Containing 4 (FBXW4)
fbxw4, FBXW4, Fbxw4
Insert length:
879 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4767268
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

F-Box and WD Repeat Domain Containing 4 (FBXW4)
fbxw4, FBXW4, Fbxw4
Insert length:
879 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4761975
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
F-Box and WD Repeat Domain Containing 4 (FBXW4)
fbxw4, FBXW4, Fbxw4
Insert length:
879 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4475600
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
F-Box and WD Repeat Domain Containing 4 (FBXW4)
fbxw4, FBXW4, Fbxw4
Insert length:
879 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4436695
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
F-Box and WD Repeat Domain Containing 4 (FBXW4)
Gene ID:
6468 (Human, FBXW4)
fbxw4, FBXW4, Fbxw4
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3409532
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
F-Box and WD Repeat Domain Containing 4 (FBXW4)
NCBI Accession:
fbxw4, FBXW4, Fbxw4
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FBXW4
Viral Particles
-80 °C
Catalog No. ABIN5137104
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
F-Box and WD Repeat Domain Containing 4 (FBXW4)
NCBI Accession:
fbxw4, FBXW4, Fbxw4
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Fbxw4
Viral Particles
-80 °C
Catalog No. ABIN5137108
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
F-Box and WD Repeat Domain Containing 4 (FBXW4)
NCBI Accession:
fbxw4, FBXW4, Fbxw4
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Fbxw4
Viral Particles
-80 °C
Catalog No. ABIN5137106
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Protein Expression
F-Box and WD Repeat Domain Containing 4 (FBXW4)
NCBI Accession:
fbxw4, FBXW4, Fbxw4
Insert length:
1227 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5432892
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days

Protein Expression
F-Box and WD Repeat Domain Containing 4 (FBXW4)
NCBI Accession:
fbxw4, FBXW4, Fbxw4
Insert length:
1227 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3292911
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days
  • <
  • 1

Synonyms and alternative names related to FBXW4

  • F-box and WD repeat domain containing 4 (fbxw4)
  • F-box and WD repeat domain containing 4 (FBXW4)
  • F-box and WD repeat domain containing 4 (Fbxw4)
  • F-box and WD-40 domain protein 4 (Fbxw4)
  • dac
  • DAC
  • Dac
  • dactylin
  • dactylyn
  • FBW4
  • Fbw4
  • FBWD4
  • FBXW4
  • hag
  • hagoromo
  • SHFM3
  • SHSF3
  • wu:fk63g06

Gene-IDs for different species

58035 Danio rerio
450689 Pan troglodytes
6468 Homo sapiens
309444 Rattus norvegicus
100721914 Cavia porcellus
101113450 Ovis aries
30838 Mus musculus

Protein level used designations for FBXW4

  • F-box/WD repeat-containing protein 4
  • dactylaplasia
  • fk63g06
  • F-box and WD repeat domain containing 4
  • F-box and WD-40 domain protein 4
  • F-box and WD-40 domain-containing protein 4
  • F-box/WD repeat protein 4
  • dactylin
  • F-box protein Fbw4
  • protein hagoromo
Other products related to FBXW4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com