FUT9 (Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase), FUT9)

Short Description: The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011].
More information related to gene FUT9.
Products related to FUT9 Gene:
115 Products
Type
  • 109
  • 6
Species
  • 51
  • 32
  • 28
  • 2
  • 2
Application
  • 61
  • 27
  • 26
  • 16
  • 1
Fusion tag
  • 42
  • 16
  • 11
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 39
  • 36
  • 12
  • 9
  • 9
Insert
  • 38
  • 34
  • 21
  • 8
  • 6
Oligo-Type
  • 5
  • 1
Resistance Gene
  • 45
  • 41
  • 18
  • 5
  • 2
Expression Type
  • 88
  • 50
  • 11
  • 2
Selectable Marker
  • 29
  • 26
  • 11
  • 1
Promoter
  • 31
  • 31
  • 19
  • 13
  • 8
Format
  • 49
  • 27
  • 22
  • 17

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Gene ID:
492813 (Zebrafish (Danio rerio), FUT9)
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4076858
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Gene ID:
14348 (Mouse (Murine), FUT9)
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002354
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Gene ID:
14348 (Mouse (Murine), FUT9)
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002353
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Gene ID:
548391 (Xenopus tropicalis, FUT9)
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4026814
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Gene ID:
10690 (Human, FUT9)
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4212059
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Species:
Human
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3560218
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase)
Species:
Human
Synonyms:
cb66, sb:cb66, zgc:101612, CFUC-TIX, ATFUT9, F7A19.19, F7A19_19, fucosyltransferase 9, AI746471, AU067636, mFUT9, mFuc-TIX, Fuc-TIX, FucT-IX
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190242
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Gene ID:
492813 (Zebrafish (Danio rerio), FUT9)
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4076859
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Species:
Human
Synonyms:
fut9b, FUT9, fut9, Fut9
Insert length:
1080 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5752494
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Gene ID:
14348 (Mouse (Murine), FUT9)
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002351
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Gene ID:
14348 (Mouse (Murine), FUT9)
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002352
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Gene ID:
548391 (Xenopus tropicalis, FUT9)
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4026815
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Gene ID:
10690 (Human, FUT9)
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4212060
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Gene ID:
10690 (Human, FUT9)
Synonyms:
fut9b, FUT9, fut9, Fut9
Insert length:
1080 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316704
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Species:
Human
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3899972
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Species:
Human
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3899969
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Species:
Human
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3899967
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Species:
Human
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3899975
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Species:
Human
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3899973
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Fucosyltransferase 9 (Alpha (1,3) Fucosyltransferase) (FUT9)
Species:
Human
Synonyms:
fut9b, FUT9, fut9, Fut9
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3899971
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to FUT9

  • fucosyltransferase 9b (fut9b)
  • fucosyltransferase 9 (FUT9)
  • fucosyltransferase 9 (fut9)
  • fucosyltransferase 9 (Fut9)
  • AI746471
  • ATFUT9
  • AU067636
  • cb66
  • CFUC-TIX
  • F7A19.19
  • F7A19_19
  • Fuc-TIX
  • fucosyltransferase 9
  • FucT-IX
  • mFuc-TIX
  • mFUT9
  • sb:cb66
  • zgc:101612

Gene-IDs for different species

GENE IDSPECIES
492813 Danio rerio
771133 Gallus gallus
837970 Arabidopsis thaliana
100136100 Oncorhynchus mykiss
100195769 Salmo salar
14348 Mus musculus
100689036 Cricetulus griseus
10690 Homo sapiens
84597 Rattus norvegicus
282853 Bos taurus
449027 Canis lupus familiaris

Protein level used designations for FUT9

  • Fut9B
  • alpha-1,3-fucosyltransferase 9B
  • alpha-(1,3)-fucosyltransferase
  • cFUT9
  • fucosyltransferase 9
  • alpha3-fucosyltransferase 9
  • Alpha-1,3-fucosyltransferase
  • fuc-TIX
  • fucT-IX
  • fucosyltransferase IX
  • galactoside 3-L-fucosyltransferase
  • Fucosyltransferase IX
  • Galactoside 3-L-fucosyltransferase
  • alpha (1,3) fucosyltransferase type IX
  • alpha-1,3-fucosyltransferase 9
Other products related to FUT9 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com