G6PC (Glucose 6-Phosphatase, Catalytic, G6PC)

Short Description: Glucose-6-phosphatase (G6Pase) is a multi-subunit integral membrane protein of the endoplasmic reticulum that is composed of a catalytic subunit and transporters for G6P, inorganic phosphate, and glucose. This gene (G6PC) is one of the three glucose-6-phosphatase catalytic-subunit-encoding genes in human: G6PC, G6PC2 and G6PC3. Glucose-6-phosphatase catalyzes the hydrolysis of D-glucose 6-phosphate to D-glucose and orthophosphate and is a key enzyme in glucose homeostasis, functioning in gluconeogenesis and glycogenolysis. Mutations in this gene cause glycogen storage disease type I (GSD1). This disease, also known as von Gierke disease, is a metabolic disorder characterized by severe hypoglycemia associated with the accumulation of glycogen and fat in the liver and kidneys.[provided by RefSeq, Feb 2011].
More information related to gene G6PC.
Products related to G6PC Gene:
115 Products
Type
  • 108
  • 7
Species
  • 40
  • 38
  • 29
  • 4
  • 2
Application
  • 60
  • 33
  • 27
  • 16
  • 1
Fusion tag
  • 48
  • 13
  • 11
  • 8
  • 6
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 4
Vector
  • 42
  • 32
  • 12
  • 10
  • 9
Insert
  • 43
  • 28
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 45
  • 41
  • 16
  • 6
  • 2
Expression Type
  • 87
  • 50
  • 11
  • 2
Selectable Marker
  • 28
  • 26
  • 11
  • 1
Promoter
  • 31
  • 26
  • 25
  • 13
  • 8
Format
  • 43
  • 27
  • 23
  • 22

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
379290 (Xenopus laevis, G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3842293
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
14377 (Mouse (Murine), G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3808738
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
538710 (Cow (Bovine), G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3863455
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
25634 (Rat (Rattus), G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045969
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
2538 (Human, G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999051
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
2538 (Human, G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999049
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
379852 (Xenopus laevis, G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041136
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
NCBI Accession:
NM_013098
Species:
Rat (Rattus)
Synonyms:
G6pc, G6PC
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886937
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Glucose 6-Phosphatase, Catalytic
Species:
Rat (Rattus)
Synonyms:
AW107337, G6Pase, G6pt, Glc-6-Pase, G6PC1, G6PT, GSD1, GSD1a, G-6-Pase
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3197085
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
379290 (Xenopus laevis, G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3842294
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
14377 (Mouse (Murine), G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3808739
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
538710 (Cow (Bovine), G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3863453
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
25634 (Rat (Rattus), G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045968
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
2538 (Human, G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999050
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
2538 (Human, G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999052
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
379852 (Xenopus laevis, G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041137
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
2538 (Human, G6PC)
Synonyms:
G6pc, G6PC
Insert length:
1074 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5326573
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
2538 (Human, G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3398602
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
Gene ID:
2538 (Human, G6PC)
Synonyms:
G6pc, G6PC
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3428114
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Glucose 6-Phosphatase, Catalytic (G6PC)
NCBI Accession:
NM_013098,NP_037230
Species:
Rat (Rattus)
Synonyms:
G6pc, G6PC
Insert length:
1074 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3289390
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to G6PC

  • glucose-6-phosphatase, catalytic (G6pc)
  • glucose-6-phosphatase catalytic subunit (G6PC)
  • glucose-6-phosphatase, catalytic subunit (G6pc)
  • AW107337
  • G-6-Pase
  • G6Pase
  • G6PC1
  • G6pt
  • G6PT
  • Glc-6-Pase
  • GSD1
  • GSD1a

Gene-IDs for different species

GENE IDSPECIES
14377 Mus musculus
2538 Homo sapiens
403492 Canis lupus familiaris
100134959 Sus scrofa
538710 Bos taurus
25634 Rattus norvegicus
723970 Felis catus

Protein level used designations for G6PC

  • G-6-Pase
  • Glc-6-Pase-alpha
  • glucose-6-phosphatase
  • G6Pase
  • G6Pase-alpha
  • glucose-6-phosphatase alpha
  • glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)
  • glucose-6-phosphatase catalytic subunit
Other products related to G6PC such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com