GAPT (GRB2-Binding Adaptor Protein, Transmembrane, GAPT)

Short Description: Negatively regulates B-cell proliferation following stimulation through the B-cell receptor. May play an important role in maintenance of marginal zone (MZ) B-cells.
More information related to gene GAPT.
Products related to GAPT Gene:
93 Products
Type
  • 90
  • 3
Species
  • 34
  • 32
  • 25
  • 2
Application
  • 47
  • 23
  • 23
  • 16
Fusion tag
  • 32
  • 15
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 35
  • 27
  • 12
  • 9
  • 7
Insert
  • 35
  • 20
  • 19
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 37
  • 32
  • 18
  • 3
  • 2
Expression Type
  • 86
  • 48
Selectable Marker
  • 26
  • 24
  • 4
Promoter
  • 30
  • 30
  • 13
  • 9
  • 8
Format
  • 32
  • 27
  • 22
  • 12

Type:
ORF
Application:
Protein Expression
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
NCBI Accession:
NM_152687,NP_689900
Species:
Human
Synonyms:
GAPT, Gapt
Insert length:
474 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5487449
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
Gene ID:
784765 (Cow (Bovine), GAPT)
Synonyms:
GAPT, Gapt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3871081
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
Gene ID:
202309 (Human, GAPT)
Synonyms:
GAPT, Gapt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3833495
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
Gene ID:
238875 (Mouse (Murine), GAPT)
Synonyms:
GAPT, Gapt
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3993663
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
Gene ID:
238875 (Mouse (Murine), GAPT)
Synonyms:
GAPT, Gapt
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3993664
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
Gene ID:
784765 (Cow (Bovine), GAPT)
Synonyms:
GAPT, Gapt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3871082
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
Gene ID:
202309 (Human, GAPT)
Synonyms:
GAPT, Gapt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3833493
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
Gene ID:
238875 (Mouse (Murine), GAPT)
Synonyms:
GAPT, Gapt
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3993665
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
Gene ID:
238875 (Mouse (Murine), GAPT)
Synonyms:
GAPT, Gapt
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3993666
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
NCBI Accession:
NM_152687,NP_689900
Species:
Human
Synonyms:
GAPT, Gapt
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3378146
$310.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
NCBI Accession:
NM_001109491,NP_001102961
Species:
Rat (Rattus)
Synonyms:
GAPT, Gapt
Insert length:
471 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5487450
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
NCBI Accession:
NM_177713,NP_808381
Species:
Mouse (Murine)
Synonyms:
GAPT, Gapt
Insert length:
474 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3289555
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
NCBI Accession:
NM_001109491,NP_001102961
Species:
Rat (Rattus)
Synonyms:
GAPT, Gapt
Insert length:
471 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3289556
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
NCBI Accession:
NM_001109491
Species:
Rat (Rattus)
Synonyms:
GAPT, Gapt
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gapt
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5172258
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
NCBI Accession:
NM_177713
Species:
Mouse (Murine)
Synonyms:
GAPT, Gapt
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gapt
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5172256
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
NCBI Accession:
NM_152687
Species:
Human
Synonyms:
GAPT, Gapt
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of GAPT
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5172254
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Application:
RNA Interference
Gene:
GRB2-Binding Adaptor Protein, Transmembrane
Species:
Mouse (Murine)
Synonyms:
C5orf29, 9830130M13Rik
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • 9830130M13Rik (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3277420
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
Species:
Human
Synonyms:
GAPT, Gapt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5487448
$460.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
Gene ID:
202309 (Human, GAPT)
Synonyms:
GAPT, Gapt
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5051022

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5032077
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Cloning
Gene:
GRB2-Binding Adaptor Protein, Transmembrane (GAPT)
NCBI Accession:
NM_152687
Species:
Human
Synonyms:
GAPT, Gapt
Insert length:
474 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5767626
$511.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
  • <
  • 1

Synonyms and alternative names related to GAPT

  • GRB2 binding adaptor protein, transmembrane (GAPT)
  • Grb2-binding adaptor, transmembrane (Gapt)
  • 9830130M13Rik
  • C5orf29

Gene-IDs for different species

GENE IDSPECIES
202309 Homo sapiens
238875 Mus musculus

Protein level used designations for GAPT

  • GRB2-binding transmembrane adaptor
  • growth factor receptor-bound protein 2-binding adapter protein, transmembrane
  • protein GAPT
Other products related to GAPT such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com