GCKR (Glucokinase (Hexokinase 4) Regulator, GCKR)

Short Description: This gene encodes a protein belonging to the GCKR subfamily of the SIS (Sugar ISomerase) family of proteins. The gene product is a regulatory protein that inhibits glucokinase in liver and pancreatic islet cells by binding non-covalently to form an inactive complex with the enzyme. This gene is considered a susceptibility gene candidate for a form of maturity-onset diabetes of the young (MODY). [provided by RefSeq, Jul 2008].
More information related to gene GCKR.
Products related to GCKR Gene:
129 Products
Data Quality
  • 1
Type
  • 122
  • 7
Species
  • 56
  • 43
  • 28
  • 2
Application
  • 77
  • 28
  • 25
  • 16
  • 1
Fusion tag
  • 44
  • 16
  • 13
  • 10
  • 7
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 4
Vector
  • 55
  • 34
  • 12
  • 9
  • 8
Insert
  • 49
  • 38
  • 19
  • 8
  • 6
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 57
  • 41
  • 18
  • 6
  • 2
Expression Type
  • 87
  • 48
  • 26
Selectable Marker
  • 28
  • 26
  • 24
  • 1
Promoter
  • 37
  • 31
  • 31
  • 13
  • 8
Format
  • 65
  • 27
  • 21
  • 16

Type:
cDNA
Application:
Cloning
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
2646 (Human, GCKR)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999113
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
2646 (Human, GCKR)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999114
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
25658 (Rat (Rattus), GCKR)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045987
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
231103 (Mouse (Murine), GCKR)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3836375
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
398839 (Xenopus laevis, GCKR)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846123
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
NCBI Accession:
NM_144909
Species:
Mouse (Murine)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3560304
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Species:
Human
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3888168
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Glucokinase (Hexokinase 4) Regulator
Species:
Human
Synonyms:
FGQTL5, GKRP, GLRE, gckr
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3192629
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
2646 (Human, GCKR)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999111
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
2646 (Human, GCKR)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999112
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
25658 (Rat (Rattus), GCKR)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045986
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
231103 (Mouse (Murine), GCKR)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3836377
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
398839 (Xenopus laevis, GCKR)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846124
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
2646 (Human, GCKR)
Synonyms:
GCKR, Gckr, gckr.L
Insert length:
1878 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5324069
$199.17
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
2646 (Human, GCKR)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3398603
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
2646 (Human, GCKR)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3428032
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
NCBI Accession:
NM_001486
Species:
Human
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of GCKR
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5137922
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
NCBI Accession:
NM_144909
Species:
Mouse (Murine)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gckr
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5137924
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
NCBI Accession:
NM_013120
Species:
Rat (Rattus)
Synonyms:
GCKR, Gckr, gckr.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gckr
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5137926
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Glucokinase (Hexokinase 4) Regulator (GCKR)
NCBI Accession:
NM_001486,NP_001477
Species:
Human
Synonyms:
GCKR, Gckr, gckr.L
Insert length:
1875 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5434231
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to GCKR

  • glucokinase regulator (GCKR)
  • glucokinase regulator (Gckr)
  • glucokinase regulatory protein (Gckr)
  • glucokinase regulator L homeolog (gckr.L)
  • FGQTL5
  • gckr
  • GKRP
  • GLRE

Gene-IDs for different species

GENE IDSPECIES
2646 Homo sapiens
25658 Rattus norvegicus
231103 Mus musculus
398839 Xenopus laevis
475705 Canis lupus familiaris
100071177 Equus caballus
100625192 Sus scrofa
100728544 Cavia porcellus
100350724 Oryctolagus cuniculus
100140421 Bos taurus

Protein level used designations for GCKR

  • glucokinase regulatory protein
  • glucokinase regulator
  • LOW QUALITY PROTEIN: glucokinase regulatory protein
  • glucokinase (hexokinase 4) regulator
Other products related to GCKR such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com