GCKR (Glucokinase (Hexokinase 4) Regulator, GCKR)

Short Description: This gene encodes a protein belonging to the GCKR subfamily of the SIS (Sugar ISomerase) family of proteins. The gene product is a regulatory protein that inhibits glucokinase in liver and pancreatic islet cells by binding non-covalently to form an inactive complex with the enzyme. This gene is considered a susceptibility gene candidate for a form of maturity-onset diabetes of the young (MODY). [provided by RefSeq, Jul 2008].
More information related to gene GCKR.
Products related to GCKR Gene:
Data Quality
  • 1
  • 114
  • 4
  • 52
  • 40
  • 25
  • 1
  • 74
  • 23
  • 19
  • 16
  • 1
Fusion tag
  • 36
  • 13
  • 13
  • 10
  • 7
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 4
  • 49
  • 34
  • 12
  • 9
  • 6
  • 49
  • 33
  • 16
  • 8
  • 6
  • 3
  • 1
Resistance Gene
  • 54
  • 36
  • 18
  • 6
  • 2
Expression Type
  • 81
  • 45
  • 26
Selectable Marker
  • 26
  • 24
  • 23
  • 1
  • 34
  • 28
  • 28
  • 13
  • 8
  • 59
  • 27
  • 21
  • 11
118 Products

Glucokinase (Hexokinase 4) Regulator (GCKR)
GCKR, Gckr, gckr.L
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Catalog No. ABIN3888168
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Glucokinase (Hexokinase 4) Regulator (GCKR)
NCBI Accession:
GCKR, Gckr, gckr.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3560304
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Protein Expression, Cloning
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
25658 (Rat, GCKR)
GCKR, Gckr, gckr.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4045986
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
2646 (Human, GCKR)
GCKR, Gckr, gckr.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3999111
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
2646 (Human, GCKR)
GCKR, Gckr, gckr.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3999112
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
398839 (Xenopus laevis, GCKR)
GCKR, Gckr, gckr.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3846124
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
231103 (Mouse, GCKR)
GCKR, Gckr, gckr.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3836377
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Quantitative real-time PCR
Glucokinase (Hexokinase 4) Regulator
-20 °C
Catalog No. ABIN3192629
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
2646 (Human, GCKR)
GCKR, Gckr, gckr.L
Insert length:
1878 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5324069
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
2646 (Human, GCKR)
GCKR, Gckr, gckr.L
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3398603
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Glucokinase (Hexokinase 4) Regulator (GCKR)
Gene ID:
2646 (Human, GCKR)
GCKR, Gckr, gckr.L
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3428032
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Glucokinase (Hexokinase 4) Regulator (GCKR)
NCBI Accession:
GCKR, Gckr, gckr.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of GCKR
Viral Particles
-80 °C
Catalog No. ABIN5137922
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Glucokinase (Hexokinase 4) Regulator (GCKR)
NCBI Accession:
GCKR, Gckr, gckr.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gckr
Viral Particles
-80 °C
Catalog No. ABIN5137926
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Glucokinase (Hexokinase 4) Regulator (GCKR)
NCBI Accession:
GCKR, Gckr, gckr.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gckr
Viral Particles
-80 °C
Catalog No. ABIN5137924
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Protein Expression
Glucokinase (Hexokinase 4) Regulator (GCKR)
NCBI Accession:
GCKR, Gckr, gckr.L
Insert length:
1875 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5434231
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

RNA Interference
Glucokinase (Hexokinase 4) Regulator
HPLC purified
Available with shipment
  • GCKR (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3341548
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Glucokinase (Hexokinase 4) Regulator
HPLC purified
Available with shipment
  • Gckr (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3265345
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Glucokinase (Hexokinase 4) Regulator
HPLC purified
Available with shipment
  • Gckr (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3359381
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Glucokinase (Hexokinase 4) Regulator (GCKR)
GCKR, Gckr, gckr.L
Insert length:
1878 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5750489
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Glucokinase (Hexokinase 4) Regulator (GCKR)
GCKR, Gckr, gckr.L
Insert length:
1878 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4702887
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to GCKR

  • glucokinase regulator (GCKR)
  • glucokinase regulator (Gckr)
  • glucokinase regulatory protein (Gckr)
  • glucokinase regulator L homeolog (gckr.L)
  • FGQTL5
  • gckr
  • GKRP
  • GLRE

Gene-IDs for different species

2646 Homo sapiens
25658 Rattus norvegicus
231103 Mus musculus
398839 Xenopus laevis
475705 Canis lupus familiaris
100071177 Equus caballus
100625192 Sus scrofa
100728544 Cavia porcellus
100350724 Oryctolagus cuniculus
100140421 Bos taurus

Protein level used designations for GCKR

  • glucokinase regulatory protein
  • glucokinase regulator
  • LOW QUALITY PROTEIN: glucokinase regulatory protein
  • glucokinase (hexokinase 4) regulator
Other products related to GCKR such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com