GDA (Guanine Deaminase, GDA)

Short Description: This gene encodes an enzyme responsible for the hydrolytic deamination of guanine. Studies in rat ortholog suggest this gene plays a role in microtubule assembly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011].
More information related to gene GDA.
Products related to GDA Gene:
112 Products
Data Quality
  • 1
Type
  • 107
  • 5
Species
  • 47
  • 35
  • 26
  • 2
  • 2
Application
  • 65
  • 25
  • 24
  • 16
Fusion tag
  • 38
  • 20
  • 15
  • 9
  • 8
Vector Backbone
  • 8
  • 8
  • 8
  • 6
  • 6
Vector
  • 40
  • 38
  • 12
  • 9
  • 5
Insert
  • 36
  • 35
  • 20
  • 8
  • 6
Oligo-Type
  • 5
Resistance Gene
  • 42
  • 37
  • 22
  • 6
  • 2
Expression Type
  • 102
  • 54
Selectable Marker
  • 30
  • 26
  • 1
Promoter
  • 42
  • 30
  • 13
  • 11
  • 8
Format
  • 46
  • 27
  • 24
  • 15

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Guanine Deaminase (GDA)
Gene ID:
398728 (Xenopus laevis, GDA)
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845937
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Guanine Deaminase (GDA)
Gene ID:
9615 (Human, GDA)
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3806562
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Guanine Deaminase (GDA)
Species:
Human
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Insert length:
1365 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5752721
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Guanine Deaminase (GDA)
Gene ID:
398728 (Xenopus laevis, GDA)
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845936
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Guanine Deaminase (GDA)
Gene ID:
9615 (Human, GDA)
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3806564
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Guanine Deaminase (GDA)
Gene ID:
9615 (Human, GDA)
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Insert length:
1365 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5320723
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Guanine Deaminase (GDA)
NCBI Accession:
NM_004293,NP_004284
Species:
Human
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Insert length:
5000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Murphy, Bolduc, Gallaher, Stoddard, Baker: "Alteration of enzyme specificity by computational loop remodeling and design." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 106, Issue 23, pp. 9215-20, 2009 (Pubmed)
Catalog No. ABIN3378161
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Guanine Deaminase (GDA)
Species:
Human
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Insert length:
1365 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4437054
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Guanine Deaminase (GDA)
Species:
Human
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Insert length:
1365 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4475959
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Guanine Deaminase (GDA)
Species:
Human
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Insert length:
1365 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4702901
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Guanine Deaminase (GDA)
Species:
Human
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Insert length:
1365 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4762334
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Guanine Deaminase (GDA)
Species:
Human
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Insert length:
1365 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4767627
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Guanine Deaminase (GDA)
Species:
Human
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Insert length:
1365 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4832031
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Guanine Deaminase (GDA)
Gene ID:
9615 (Human, GDA)
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3397652
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Guanine Deaminase (GDA)
Gene ID:
9615 (Human, GDA)
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3429479
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Guanine Deaminase (GDA)
NCBI Accession:
NM_004293,NP_004284
Species:
Human
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Insert length:
1365 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5441522
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Guanine Deaminase (GDA)
NCBI Accession:
NM_001242506,NP_001229435
Species:
Human
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Insert length:
1143 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5441523
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Guanine Deaminase (GDA)
NCBI Accession:
NM_001242507,NP_001229436
Species:
Human
Synonyms:
GDA, Gda, gda.L, gda, SPO2956, Gdia_3192, Mchl_2046, Mnod_4655, guaD, Dd586_1771, Kvar_2512, Mrub_1462, BC1002_2263, Cseg_1079, Mesil_1795, Trad_2850, Mesop_0346, gDA, ML5_2802
Insert length:
1143 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5441524
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Application:
RNA Interference
Gene:
Guanine Deaminase
Species:
Human
Synonyms:
CYPIN, GUANASE, NEDASIN, AU015411, AW047581, Cypin, MGC81835, zgc:112282, AGR_C_4212, DDBDRAFT_0169373, DDBDRAFT_0230211, DDB_0169373, DDB_0230211
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • GDA (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3346155
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Guanine Deaminase
Species:
Mouse (Murine)
Synonyms:
CYPIN, GUANASE, NEDASIN, AU015411, AW047581, Cypin, MGC81835, zgc:112282, AGR_C_4212, DDBDRAFT_0169373, DDBDRAFT_0230211, DDB_0169373, DDB_0230211
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Gda (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3269092
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to GDA

  • guanine deaminase (GDA)
  • guanine deaminase (Gda)
  • guanine deaminase L homeolog (gda.L)
  • guanine deaminase (gda)
  • guanine deaminase (SPO2956)
  • guanine deaminase (Gdia_3192)
  • guanine deaminase (Mchl_2046)
  • guanine deaminase (Mnod_4655)
  • guanine deaminase (guaD)
  • guanine deaminase (Dd586_1771)
  • guanine deaminase (Kvar_2512)
  • guanine deaminase (Mrub_1462)
  • guanine deaminase (BC1002_2263)
  • guanine deaminase (Cseg_1079)
  • guanine deaminase (Mesil_1795)
  • guanine deaminase (Trad_2850)
  • guanine deaminase (Mesop_0346)
  • guanine deaminase (gDA)
  • short-chain dehydrogenase/reductase sdr (ML5_2802)
  • AGR_C_4212
  • AU015411
  • AW047581
  • CYPIN
  • Cypin
  • DDBDRAFT_0169373
  • DDBDRAFT_0230211
  • DDB_0169373
  • DDB_0230211
  • GUANASE
  • MGC81835
  • NEDASIN
  • zgc:112282

Gene-IDs for different species

GENE IDSPECIES
9615 Homo sapiens
14544 Mus musculus
83585 Rattus norvegicus
398728 Xenopus laevis
427253 Gallus gallus
472950 Pan troglodytes
484169 Canis lupus familiaris
525937 Bos taurus
553701 Danio rerio
701796 Macaca mulatta
1134353 Agrobacterium fabrum str. C58
3193915 Ruegeria pomeroyi DSS-3
6976632 Gluconacetobacter diazotrophicus PAl 5
7118746 Methylobacterium extorquens CM4
7305814 Methylobacterium nodulans ORS 2060
8621189 Dictyostelium discoideum AX4
8660710 Dickeya dadantii Ech586
8782671 Klebsiella variicola At-22
8879563 Meiothermus ruber DSM 1279
9089967 Burkholderia sp. CCGE1002
9102572 Caulobacter segnis ATCC 21756
9251305 Meiothermus silvanus DSM 9946
9281863 Truepera radiovictrix DSM 17093
10268014 Agrobacterium sp. H13-3
10824153 Mesorhizobium opportunistum WSM2075
10887491 Simkania negevensis Z
100050096 Equus caballus
100174441 Pongo abelii
100408213 Callithrix jacchus
100464046 Ailuropoda melanoleuca
100562603 Anolis carolinensis
10058316 Micromonospora sp. L5
100344028 Oryctolagus cuniculus
100727963 Cavia porcellus

Protein level used designations for GDA

  • GAH
  • cytoplasmic PSD95 interactor
  • guanine aminase
  • guanine aminohydrolase
  • p51-nedasin
  • guanase
  • guanine deaminase
  • short-chain dehydrogenase/reductase sdr
Other products related to GDA such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com