Glycophorin A (Glycophorin A (MNS Blood Group), GYPA)

Short Description: Glycophorins A (GYPA) and B (GYPB) are major sialoglycoproteins of the human erythrocyte membrane which bear the antigenic determinants for the MN and Ss blood groups. In addition to the M or N and S or s antigens that commonly occur in all populations, about 40 related variant phenotypes have been identified. These variants include all the variants of the Miltenberger complex and several isoforms of Sta, as well as Dantu, Sat, He, Mg, and deletion variants Ena, S-s-U- and Mk. Most of the variants are the result of gene recombinations between GYPA and GYPB. [provided by RefSeq, Jul 2008].
More information related to gene Glycophorin A.
Products related to Glycophorin A Gene:
109 Products
Type
  • 105
  • 4
Species
  • 53
  • 43
  • 13
Application
  • 62
  • 25
  • 17
  • 12
  • 1
Fusion tag
  • 35
  • 13
  • 11
  • 7
  • 7
Vector Backbone
  • 4
  • 4
  • 4
  • 4
  • 4
Vector
  • 45
  • 25
  • 12
  • 11
  • 6
Insert
  • 45
  • 34
  • 14
  • 6
  • 4
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 53
  • 28
  • 16
  • 8
  • 2
Expression Type
  • 69
  • 41
  • 22
Selectable Marker
  • 23
  • 22
  • 18
  • 2
  • 1
Promoter
  • 27
  • 27
  • 22
  • 13
  • 6
Format
  • 53
  • 27
  • 15
  • 14

Type:
ORF
Application:
Cloning
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
Species:
Human
Synonyms:
GYPA, Gypa
Insert length:
453 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5749507
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
Species:
Human
Synonyms:
GYPA, Gypa
Insert length:
453 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5749508
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
NCBI Accession:
NM_002099,NP_002090
Species:
Human
Synonyms:
GYPA, Gypa
Insert length:
453 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5431025
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
NCBI Accession:
NM_001308187
Gene ID:
2993 (Human, GYPA)
Synonyms:
GYPA, Gypa
Insert length:
414 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4928949
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
NCBI Accession:
NM_001308190
Gene ID:
2993 (Human, GYPA)
Synonyms:
GYPA, Gypa
Insert length:
354 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4928950
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
NCBI Accession:
NM_002099
Gene ID:
2993 (Human, GYPA)
Synonyms:
GYPA, Gypa
Insert length:
453 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4938925
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
Gene ID:
2993 (Human, GYPA)
Synonyms:
GYPA, Gypa
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034781
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
Gene ID:
2993 (Human, GYPA)
Synonyms:
GYPA, Gypa
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034782
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
Gene ID:
14934 (Mouse (Murine), GYPA)
Synonyms:
GYPA, Gypa
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988002
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
NCBI Accession:
NM_010369
Species:
Mouse (Murine)
Synonyms:
GYPA, Gypa
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3560685
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
NCBI Accession:
XM_001069014
Species:
Rat (Rattus)
Synonyms:
GYPA, Gypa
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887014
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Glycophorin A (MNS Blood Group)
Species:
Rat (Rattus)
Synonyms:
GYPA, gpa, AI853584, CD235a, GPA, GPErik, GPSAT, HGpMiV, HGpMiXI, HGpSta(C), MN, MNS, PAS-2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3197254
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
Gene ID:
2993 (Human, GYPA)
Synonyms:
GYPA, Gypa
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034783
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
Gene ID:
2993 (Human, GYPA)
Synonyms:
GYPA, Gypa
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034784
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
Gene ID:
14934 (Mouse (Murine), GYPA)
Synonyms:
GYPA, Gypa
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988003
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
Gene ID:
2993 (Human, GYPA)
Synonyms:
GYPA, Gypa
Insert length:
453 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5315340
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
Gene ID:
2993 (Human, GYPA)
Synonyms:
GYPA, Gypa
Insert length:
453 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5315344
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
NCBI Accession:
XM_001069014
Species:
Rat (Rattus)
Synonyms:
GYPA, Gypa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3904664
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
NCBI Accession:
XM_001069014
Species:
Rat (Rattus)
Synonyms:
GYPA, Gypa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3904666
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glycophorin A (MNS Blood Group) (GYPA)
NCBI Accession:
XM_001069014
Species:
Rat (Rattus)
Synonyms:
GYPA, Gypa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3904668
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to Glycophorin A

  • glycophorin A (MNS blood group) (GYPA)
  • glycophorin A (GYPA)
  • glycophorin A (Gypa)
  • AI853584
  • CD235a
  • gpa
  • GPA
  • GPErik
  • GPSAT
  • GYPA
  • HGpMiV
  • HGpMiXI
  • HGpSta(C)
  • MN
  • MNS
  • PAS-2

Gene-IDs for different species

GENE IDSPECIES
574101 Macaca mulatta
617836 Bos taurus
14934 Mus musculus
2993 Homo sapiens
100126181 Canis lupus familiaris
461520 Pan troglodytes
100525591 Sus scrofa

Protein level used designations for Glycophorin A

  • glycophorin A
  • glycophorin-A
  • MN sialoglycoprotein
  • Mi.V glycoprotein (24 AA)
  • erythroid-lineage-specific membrane sialoglycoprotein
  • glycophorin A (MN blood group)
  • glycophorin A, GPA
  • glycophorin Erik
  • glycophorin MiI
  • glycophorin MiV
  • glycophorin SAT
  • glycophorin Sta type C
  • recombinant glycophorin A-B Miltenberger-DR
  • sialoglycoprotein alpha
Other products related to Glycophorin A such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com