HMGB1 (High-Mobility Group Box 1, HMGB1)

Short Description: heparin binding protein that facilitates neurite outgrowth [RGD, Feb 2006].
More information related to gene HMGB1.
Products related to HMGB1 Gene:
172 Products
Data Quality
  • 3
  • 3
Type
  • 165
  • 7
Species
  • 71
  • 65
  • 24
  • 4
  • 4
Application
  • 113
  • 63
  • 22
  • 12
  • 2
Fusion tag
  • 72
  • 18
  • 16
  • 14
  • 8
Vector Backbone
  • 23
  • 10
  • 10
  • 6
  • 5
Vector
  • 86
  • 39
  • 16
  • 14
  • 6
Insert
  • 82
  • 54
  • 17
  • 6
  • 4
Oligo-Type
  • 5
  • 2
Resistance Gene
  • 68
  • 66
  • 28
  • 3
  • 2
Expression Type
  • 123
  • 47
  • 26
Selectable Marker
  • 29
  • 26
  • 20
  • 1
Promoter
  • 62
  • 43
  • 23
  • 17
  • 6
Format
  • 70
  • 48
  • 32
  • 22

Type:
ORF
Application:
Protein Expression
Gene:
High-Mobility Group Box 1 (HMGB1)
NCBI Accession:
NM_002128,NP_002119
Species:
Human
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Insert length:
648 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5403277
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
High-Mobility Group Box 1 (HMGB1)
NCBI Accession:
NM_002128
Gene ID:
3146 (Human, HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Insert length:
648 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4938755
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
321622 (Zebrafish (Danio rerio), HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3876938
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
321622 (Zebrafish (Danio rerio), HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4072166
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
398054 (Xenopus laevis, HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845495
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809039
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809034
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
282691 (Cow (Bovine), HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3839864
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
394834 (Xenopus tropicalis, HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3881990
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
3146 (Human, HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463579
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045172
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
3146 (Human, HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Cloning Vector
Vector backbone:
pFLC1
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071189
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096508
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
3146 (Human, HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034845
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
380530 (Xenopus laevis, HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041294
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
3146 (Human, HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3469167
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
3146 (Human, HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3469165
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215280
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215281
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
Synonyms:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215282
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to HMGB1

  • high mobility group box 1 (HMGB1)
  • high mobility group box 1 (Hmgb1)
  • high-mobility group box 1 (hmgb1)
  • high mobility group box 1a (hmgb1a)
  • high mobility group box 1 L homeolog (hmgb1.L)
  • high mobility group box 1 (hmgb1)
  • high mobility group protein B1 (LOC100359149)
  • Ac2-008
  • amphoterin
  • DEF
  • HMG-1
  • hmg-1
  • hmg1
  • HMG1
  • Hmg1
  • HMG3
  • hmg3
  • hmgb1
  • HMGB1
  • ik:tdsubc_1a5
  • p30
  • sbp-1
  • SBP-1
  • wu:fb23c02
  • xx:tdsubc_1a5
  • zgc:56110
  • zgc:77104

Gene-IDs for different species

GENE IDSPECIES
3146 Homo sapiens
15289 Mus musculus
100136339 Oncorhynchus mykiss
282691 Bos taurus
321622 Danio rerio
380530 Xenopus laevis
394834 Xenopus (Silurana) tropicalis
395724 Gallus gallus
403170 Canis lupus familiaris
445521 Sus scrofa
452518 Pan troglodytes
100033873 Equus caballus
100137373 Papio anubis
100194543 Salmo salar
100328641 Oryctolagus cuniculus
100392312 Callithrix jacchus
25459 Rattus norvegicus
100754755 Cricetulus griseus
100359149 Oryctolagus cuniculus
106025160 Cavia porcellus

Protein level used designations for HMGB1

  • Amphoterin
  • HMG-1
  • Sulfoglucuronyl carbohydrate binding protein
  • high mobility group protein 1
  • high mobility group protein B1
  • high-mobility group (nonhistone chromosomal) protein 1
  • high-mobility group box 1
  • sulfoglucuronyl carbohydrate binding protein
  • high mobility group box 1
  • tdsubc_1a5
  • high mobility group 1 protein
  • high mobility group protein HMG1
  • non-histone protein HMG1
  • high mobility group protein B1-like protein
  • High mobility group protein B1
  • high mobility group protein B1-like
  • High mobility group protein 1
  • amphoterin
  • heparin-binding protein p30
  • high mobility group 1
Other products related to HMGB1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com