HMGB1 (High-Mobility Group Box 1, HMGB1)

Short Description: heparin binding protein that facilitates neurite outgrowth [RGD, Feb 2006].
More information related to gene HMGB1.
Products related to HMGB1 Gene:
Data Quality
  • 3
  • 154
  • 4
  • 65
  • 63
  • 18
  • 4
  • 4
  • 105
  • 63
  • 16
  • 4
  • 2
Fusion tag
  • 61
  • 16
  • 15
  • 14
  • 8
  • 8
Vector Backbone
  • 23
  • 10
  • 10
  • 6
  • 5
  • 83
  • 31
  • 16
  • 14
  • 6
  • 82
  • 54
  • 14
  • 2
  • 2
  • 2
  • 2
Resistance Gene
  • 63
  • 60
  • 28
  • 3
  • 2
Expression Type
  • 112
  • 36
  • 26
Selectable Marker
  • 26
  • 22
  • 16
  • 1
  • 62
  • 40
  • 17
  • 12
  • 6
  • 64
  • 48
  • 32
  • 14
158 Products

Protein Expression
High-Mobility Group Box 1 (HMGB1)
NCBI Accession:
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Insert length:
648 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5403277
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Protein Expression
High-Mobility Group Box 1 (HMGB1)
NCBI Accession:
Gene ID:
3146 (Human, HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Insert length:
648 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4938755
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
321622 (Zebrafish (Danio rerio), HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3876938
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
321622 (Zebrafish (Danio rerio), HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Glycerol Stock
-80 °C
Catalog No. ABIN4072166
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

High-Mobility Group Box 1 (HMGB1)
Gene ID:
3146 (Human, HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3469165
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

High-Mobility Group Box 1 (HMGB1)
Gene ID:
3146 (Human, HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3469167
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
3146 (Human, HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3463579
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
282691 (Cow (Bovine), HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3839864
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
394834 (Xenopus tropicalis, HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3881990
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
398054 (Xenopus laevis, HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3845495
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3809034
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3809039
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4045172
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

High-Mobility Group Box 1 (HMGB1)
Gene ID:
3146 (Human, HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4034845
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4215268
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4215269
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4215278
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4215280
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4215281
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
High-Mobility Group Box 1 (HMGB1)
Gene ID:
15289 (Mouse (Murine), HMGB1)
HMGB1, Hmgb1, hmgb1, hmgb1a, hmgb1.L, LOC100359149
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4215282
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to HMGB1

  • high mobility group box 1 (HMGB1)
  • high mobility group box 1 (Hmgb1)
  • high-mobility group box 1 (hmgb1)
  • high mobility group box 1a (hmgb1a)
  • high mobility group box 1 L homeolog (hmgb1.L)
  • high mobility group box 1 (hmgb1)
  • high mobility group protein B1 (LOC100359149)
  • Ac2-008
  • amphoterin
  • DEF
  • HMG-1
  • hmg-1
  • hmg1
  • HMG1
  • Hmg1
  • HMG3
  • hmg3
  • hmgb1
  • HMGB1
  • ik:tdsubc_1a5
  • p30
  • sbp-1
  • SBP-1
  • wu:fb23c02
  • xx:tdsubc_1a5
  • zgc:56110
  • zgc:77104

Gene-IDs for different species

3146 Homo sapiens
15289 Mus musculus
100136339 Oncorhynchus mykiss
282691 Bos taurus
321622 Danio rerio
380530 Xenopus laevis
394834 Xenopus (Silurana) tropicalis
395724 Gallus gallus
403170 Canis lupus familiaris
445521 Sus scrofa
452518 Pan troglodytes
100033873 Equus caballus
100137373 Papio anubis
100194543 Salmo salar
100328641 Oryctolagus cuniculus
100392312 Callithrix jacchus
25459 Rattus norvegicus
100754755 Cricetulus griseus
100359149 Oryctolagus cuniculus
106025160 Cavia porcellus

Protein level used designations for HMGB1

  • Amphoterin
  • HMG-1
  • Sulfoglucuronyl carbohydrate binding protein
  • high mobility group protein 1
  • high mobility group protein B1
  • high-mobility group (nonhistone chromosomal) protein 1
  • high-mobility group box 1
  • sulfoglucuronyl carbohydrate binding protein
  • high mobility group box 1
  • tdsubc_1a5
  • high mobility group 1 protein
  • high mobility group protein HMG1
  • non-histone protein HMG1
  • high mobility group protein B1-like protein
  • High mobility group protein B1
  • high mobility group protein B1-like
  • High mobility group protein 1
  • amphoterin
  • heparin-binding protein p30
  • high mobility group 1
Other products related to HMGB1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website