HUS1B (HUS1 Checkpoint Homolog B (S. Pombe), HUS1B)

Short Description: The protein encoded by this gene is most closely related to HUS1, a component of a cell cycle checkpoint protein complex involved in cell cycle arrest in response to DNA damage. This protein can interact with the check point protein RAD1 but not with RAD9. Overexpression of this protein has been shown to induce cell death, which suggests a related but distinct role of this protein, as compared to the HUS1. [provided by RefSeq, Jul 2008].
More information related to gene HUS1B.
Products related to HUS1B Gene:
95 Products
Type
  • 91
  • 4
Species
  • 38
  • 32
  • 25
Application
  • 44
  • 24
  • 23
  • 16
Fusion tag
  • 34
  • 15
  • 10
  • 9
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 35
  • 23
  • 12
  • 11
  • 9
Insert
  • 35
  • 20
  • 20
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 35
  • 34
  • 18
  • 4
  • 2
Expression Type
  • 82
  • 48
Selectable Marker
  • 33
  • 26
Promoter
  • 30
  • 30
  • 12
  • 8
  • 6
Format
  • 33
  • 27
  • 22
  • 13

Type:
cDNA
Application:
Cloning
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
Gene ID:
210554 (Mouse (Murine), HUS1B)
Synonyms:
HUS1B, Hus1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4012710
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
Gene ID:
210554 (Mouse (Murine), HUS1B)
Synonyms:
HUS1B, Hus1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4012709
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
Gene ID:
135458 (Human, HUS1B)
Synonyms:
HUS1B, Hus1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011471
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
Gene ID:
135458 (Human, HUS1B)
Synonyms:
HUS1B, Hus1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011472
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
Gene ID:
210554 (Mouse (Murine), HUS1B)
Synonyms:
HUS1B, Hus1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4012711
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
Gene ID:
210554 (Mouse (Murine), HUS1B)
Synonyms:
HUS1B, Hus1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4012712
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
Gene ID:
135458 (Human, HUS1B)
Synonyms:
HUS1B, Hus1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011473
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
Gene ID:
135458 (Human, HUS1B)
Synonyms:
HUS1B, Hus1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011474
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
Gene ID:
135458 (Human, HUS1B)
Synonyms:
HUS1B, Hus1b
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3413952
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
NCBI Accession:
NM_153072,NP_694712
Species:
Mouse (Murine)
Synonyms:
HUS1B, Hus1b
Insert length:
831 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3325728
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
NCBI Accession:
NM_001134846,NP_001128318
Species:
Rat (Rattus)
Synonyms:
HUS1B, Hus1b
Insert length:
831 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3325729
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
NCBI Accession:
NM_148959,NP_683762
Species:
Human
Synonyms:
HUS1B, Hus1b
Insert length:
837 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5435684
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
NCBI Accession:
NM_001134846,NP_001128318
Species:
Rat (Rattus)
Synonyms:
HUS1B, Hus1b
Insert length:
831 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5435685
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Application:
RNA Interference
Gene:
HUS1 Checkpoint Homolog B (S. Pombe)
Species:
Mouse (Murine)
Synonyms:
HUS1B, RP11-532F6.1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Hus1b (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3281861
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
HUS1 Checkpoint Homolog B (S. Pombe)
Species:
Human
Synonyms:
HUS1B, RP11-532F6.1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • HUS1B (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3312236
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
NCBI Accession:
NM_153072
Species:
Mouse (Murine)
Synonyms:
HUS1B, Hus1b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Hus1b
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5138812
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
NCBI Accession:
NM_001134846
Species:
Rat (Rattus)
Synonyms:
HUS1B, Hus1b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Hus1b
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5138814
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
NCBI Accession:
NM_148959
Species:
Human
Synonyms:
HUS1B, Hus1b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of HUS1B
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5138810
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
HUS1 Checkpoint Homolog B (S. Pombe) (HUS1B)
Gene ID:
135458 (Human, HUS1B)
Synonyms:
HUS1B, Hus1b
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5049357

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5030412
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
HUS1 Checkpoint Homolog B (S. Pombe)
Gene ID:
210554 (Mouse (Murine), HUS1B)
Synonyms:
HUS1B, RP11-532F6.1
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5796747
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to HUS1B

  • HUS1 checkpoint clamp component B (HUS1B)
  • HUS1 checkpoint clamp component B (Hus1b)
  • HUS1B
  • RP11-532F6.1

Gene-IDs for different species

GENE IDSPECIES
743518 Pan troglodytes
691382 Rattus norvegicus
135458 Homo sapiens
210554 Mus musculus

Protein level used designations for HUS1B

  • HUS1 checkpoint homolog b (S. pombe)
  • HUS1 checkpoint protein B
  • checkpoint protein HUS1B
  • hHUS1B
  • Hus1 checkpoint homolog b
Other products related to HUS1B such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com