ICAM5 (Intercellular Adhesion Molecule 5, ICAM5)

Short Description: The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is expressed on the surface of telencephalic neurons and displays two types of adhesion activity, homophilic binding between neurons and heterophilic binding between neurons and leukocytes. It may be a critical component in neuron-microglial cell interactions in the course of normal development or as part of neurodegenerative diseases. [provided by RefSeq, Jul 2008].
More information related to gene ICAM5.
Products related to ICAM5 Gene:
95 Products
Type
  • 91
  • 4
Species
  • 44
  • 30
  • 17
  • 2
  • 2
Application
  • 49
  • 24
  • 20
  • 16
Fusion tag
  • 34
  • 11
  • 10
  • 8
  • 7
Vector Backbone
  • 6
  • 6
  • 6
  • 4
  • 3
Vector
  • 35
  • 28
  • 12
  • 9
  • 6
Insert
  • 36
  • 23
  • 16
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 44
  • 32
  • 12
  • 3
  • 2
Expression Type
  • 73
  • 43
  • 11
Selectable Marker
  • 23
  • 22
  • 11
  • 2
Promoter
  • 26
  • 23
  • 18
  • 13
  • 8
Format
  • 38
  • 27
  • 18
  • 12

Type:
cDNA
Application:
Cloning
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
Gene ID:
494840 (Xenopus laevis, ICAM5)
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4042937
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
Gene ID:
7087 (Human, ICAM5)
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211573
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
Gene ID:
497001 (Xenopus tropicalis, ICAM5)
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4060234
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
Gene ID:
15898 (Mouse (Murine), ICAM5)
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988121
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
NCBI Accession:
NM_003259
Species:
Human
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561049
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
Gene ID:
494840 (Xenopus laevis, ICAM5)
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4042936
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
Gene ID:
7087 (Human, ICAM5)
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211572
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
Gene ID:
497001 (Xenopus tropicalis, ICAM5)
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4060235
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
Gene ID:
15898 (Mouse (Murine), ICAM5)
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988120
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
NCBI Accession:
NM_003259
Species:
Human
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3945631
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
NCBI Accession:
NM_003259
Species:
Human
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3945633
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
NCBI Accession:
NM_003259
Species:
Human
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3945634
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
NCBI Accession:
NM_003259
Species:
Human
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3945635
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
NCBI Accession:
NM_003259
Species:
Human
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3945637
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
NCBI Accession:
NM_003259
Species:
Human
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3945638
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
NCBI Accession:
NM_003259
Species:
Human
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3945639
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
NCBI Accession:
NM_003259
Species:
Human
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3945640
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
NCBI Accession:
NM_003259
Species:
Human
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3945641
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
NCBI Accession:
NM_003259
Species:
Human
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ICAM5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5090722
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Intercellular Adhesion Molecule 5 (ICAM5)
NCBI Accession:
NM_008319
Species:
Mouse (Murine)
Synonyms:
ICAM5, Icam5, LOC100511183, icam5.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Icam5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5090724
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to ICAM5

  • intercellular adhesion molecule 5 (ICAM5)
  • intercellular adhesion molecule 5, telencephalin (Icam5)
  • intercellular adhesion molecule 5 (Icam5)
  • intercellular adhesion molecule 5 (LOC100511183)
  • intercellular adhesion molecule 5 L homeolog (icam5.L)
  • CD50
  • ICAM-3
  • Icam3
  • ICAM5
  • icam5
  • TLCN
  • Tlcn
  • tlcn
  • TLN
  • tln

Gene-IDs for different species

GENE IDSPECIES
7087 Homo sapiens
15898 Mus musculus
313785 Rattus norvegicus
100328960 Oryctolagus cuniculus
455699 Pan troglodytes
484958 Canis lupus familiaris
505158 Bos taurus
100511183 Sus scrofa
100146897 Equus caballus
100718526 Cavia porcellus
494840 Xenopus laevis

Protein level used designations for ICAM5

  • ICAM-5
  • intercellular adhesion molecule 5
  • telencephalin
  • intercellular adhesion molecule 3
  • LOW QUALITY PROTEIN: intercellular adhesion molecule 5
  • intercellular adhesion molecule 5, telencephalin
  • intercellular adhesion molecule 5 L homeolog
Other products related to ICAM5 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com