IL-6 Receptor (Interleukin 6 Receptor, IL6R)

Short Description: This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.[provided by RefSeq, May 2011].
More information related to gene IL-6 Receptor.
Products related to IL-6 Receptor Gene:
118 Products
Data Quality
  • 1
  • 5
Type
  • 114
  • 4
Species
  • 75
  • 18
  • 13
  • 12
Application
  • 78
  • 24
  • 11
  • 11
  • 2
Fusion tag
  • 35
  • 15
  • 11
  • 9
  • 9
Vector Backbone
  • 6
  • 5
  • 5
  • 5
  • 4
Vector
  • 57
  • 26
  • 12
  • 7
  • 6
Insert
  • 60
  • 34
  • 9
  • 5
  • 4
Oligo-Type
  • 2
  • 2
Resistance Gene
  • 61
  • 32
  • 12
  • 9
  • 2
Expression Type
  • 68
  • 36
  • 33
Selectable Marker
  • 33
  • 25
  • 14
  • 1
Promoter
  • 38
  • 30
  • 16
  • 13
  • 6
Format
  • 62
  • 27
  • 17
  • 12

Type:
ORF
Application:
Cloning
Gene:
Interleukin-6 Receptor (IL6R)
Species:
Human
Synonyms:
IL6R, il6r, Il6r, Il6ra
Insert length:
1407 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5755129
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Interleukin-6 Receptor (IL6R)
Species:
Human
Synonyms:
IL6R, il6r, Il6r, Il6ra
Insert length:
1407 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5755130
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-6 Receptor (IL6R)
Gene ID:
3570 (Human, IL6R)
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999456
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-6 Receptor (IL6R)
Gene ID:
3570 (Human, IL6R)
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
Cloning Vector
Vector backbone:
pT7T3D-PacI
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4097392
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-6 Receptor (IL6R)
NCBI Accession:
NM_000565
Species:
Human
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887167
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-6 Receptor (IL6R)
NCBI Accession:
XM_001114404
Species:
Rhesus Monkey
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104161
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-6 Receptor (IL6R)
NCBI Accession:
NM_010559
Species:
Mouse (Murine)
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103882
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Interleukin 6 Receptor
Species:
Mouse (Murine)
Synonyms:
IL6R, il-6ra, CD126, IL-6R-1, IL-6RA, IL6Q, IL6RA, IL6RQ, gp80, IL6R1, Il6ra, IL-6Ralpha, IL-6R, Il6r
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193860
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Interleukin 6 Receptor
NCBI Accession:
NM_000565, NM_181359, NM_001206866
Species:
Human
Synonyms:
IL6R, il-6ra, CD126, IL-6R-1, IL-6RA, IL6Q, IL6RA, IL6RQ, gp80, IL6R1, Il6ra, IL-6Ralpha, IL-6R, Il6r
PCR Size:
128 bp
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188380
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-6 Receptor (IL6R)
Gene ID:
3570 (Human, IL6R)
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999457
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-6 Receptor (IL6R)
Gene ID:
3570 (Human, IL6R)
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
Cloning Vector
Vector backbone:
pT7T3D-PacI
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4097393
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Interleukin-6 Receptor (IL6R)
Gene ID:
3570 (Human, IL6R)
Synonyms:
IL6R, il6r, Il6r, Il6ra
Insert length:
1407 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5324787
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Cloning
Gene:
Interleukin-6 Receptor (IL6R)
Gene ID:
3570 (Human, IL6R)
Synonyms:
IL6R, il6r, Il6r, Il6ra
Insert length:
1407 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5324868
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin-6 Receptor (IL6R)
NCBI Accession:
NM_000565
Species:
Human
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3911525
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin-6 Receptor (IL6R)
NCBI Accession:
XM_001114404
Species:
Rhesus Monkey
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3947159
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin-6 Receptor (IL6R)
NCBI Accession:
XM_001114404
Species:
Rhesus Monkey
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3947156
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin-6 Receptor (IL6R)
NCBI Accession:
NM_000565
Species:
Human
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3911527
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin-6 Receptor (IL6R)
NCBI Accession:
NM_010559
Species:
Mouse (Murine)
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3911541
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin-6 Receptor (IL6R)
NCBI Accession:
NM_010559
Species:
Mouse (Murine)
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3911540
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin-6 Receptor (IL6R)
NCBI Accession:
NM_000565
Species:
Human
Synonyms:
IL6R, il6r, Il6r, Il6ra
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948166

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3911529
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
  • <
  • 1

Synonyms and alternative names related to IL-6 Receptor

  • interleukin 6 receptor (IL6R)
  • interleukin 6 receptor (il6r)
  • interleukin 6 receptor (Il6r)
  • interleukin 6 receptor, alpha (Il6ra)
  • CD126
  • gp80
  • IL-6R
  • IL-6R-1
  • il-6ra
  • IL-6RA
  • IL-6Ralpha
  • IL6Q
  • IL6R
  • Il6r
  • IL6R1
  • IL6RA
  • Il6ra
  • IL6RQ

Gene-IDs for different species

GENE IDSPECIES
469506 Pan troglodytes
100135755 Danio rerio
3570 Homo sapiens
24499 Rattus norvegicus
101085689 Felis catus
399522 Sus scrofa
612271 Canis lupus familiaris
507359 Bos taurus
100730490 Cavia porcellus
101103369 Ovis aries
100347752 Oryctolagus cuniculus
16194 Mus musculus

Protein level used designations for IL-6 Receptor

  • interleukin 6 receptor
  • interleukin 6 receptor alpha
  • interleukin-6 receptor subunit alpha
  • CD126 antigen
  • IL-6 receptor subunit alpha
  • IL-6R 1
  • membrane glycoprotein 80
  • IL-6R subunit alpha
  • IL-6R-alpha
  • IL-6RA
  • interleukin 6 receptor, alpha
  • IL-6 receptor alpha chain
Other products related to IL-6 Receptor such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com