IMPA2 (Inositol(myo)-1(or 4)-Monophosphatase 2, IMPA2)

Short Description: This locus encodes an inositol monophosphatase. The encoded protein catalyzes the dephosphoylration of inositol monophosphate and plays an important role in phosphatidylinositol signaling. This locus may be associated with susceptibility to bipolar disorder. [provided by RefSeq, Jan 2011].
More information related to gene IMPA2.
Products related to IMPA2 Gene:
127 Products
Type
  • 121
  • 6
Species
  • 49
  • 44
  • 30
  • 2
  • 2
Application
  • 71
  • 33
  • 27
  • 16
Fusion tag
  • 44
  • 16
  • 14
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 49
  • 36
  • 16
  • 9
  • 6
Insert
  • 46
  • 38
  • 21
  • 8
  • 6
Oligo-Type
  • 6
Resistance Gene
  • 54
  • 39
  • 20
  • 8
  • 2
Expression Type
  • 101
  • 55
  • 13
Selectable Marker
  • 30
  • 26
  • 13
  • 1
Promoter
  • 35
  • 31
  • 25
  • 16
  • 8
Format
  • 52
  • 36
  • 22
  • 17
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Species:
Human
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751537
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Species:
Human
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751538
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
NCBI Accession:
NM_014214,NP_055029
Species:
Human
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5437631
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Gene ID:
282636 (Rat (Rattus), IMPA2)
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4049212
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Gene ID:
3613 (Human, IMPA2)
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084987
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Gene ID:
100137651 (Xenopus laevis, IMPA2)
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873502
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Gene ID:
114663 (Mouse (Murine), IMPA2)
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3831275
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
NCBI Accession:
NM_053261
Species:
Mouse (Murine)
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104164
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Gene ID:
114663 (Mouse (Murine), IMPA2)
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3831276
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Gene ID:
100137651 (Xenopus laevis, IMPA2)
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873503
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Gene ID:
3613 (Human, IMPA2)
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084988
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Gene ID:
282636 (Rat (Rattus), IMPA2)
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4049213
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Gene ID:
3613 (Human, IMPA2)
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Insert length:
258 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5321915
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Gene ID:
3613 (Human, IMPA2)
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Insert length:
867 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316080
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Species:
Human
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4438071
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Species:
Human
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4438072
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Species:
Human
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4476976
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Species:
Human
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4476977
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Species:
Human
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Insert length:
258 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4833537
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Inositol(myo)-1(or 4)-Monophosphatase 2 (IMPA2)
Species:
Human
Synonyms:
IMPA2, impa2, MGYG_08537, Impa2
Insert length:
867 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4833536
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to IMPA2

  • inositol monophosphatase 2 (IMPA2)
  • inositol(myo)-1(or 4)-monophosphatase 2 (impa2)
  • inositol monophosphatase 2 (MGYG_08537)
  • inositol (myo)-1(or 4)-monophosphatase 2 (Impa2)
  • inositol monophosphatase 2 (Impa2)
  • 2210415D20Rik
  • AI326924
  • AW259601
  • zgc:110201

Gene-IDs for different species

GENE IDSPECIES
421032 Gallus gallus
455286 Pan troglodytes
553595 Danio rerio
608801 Canis lupus familiaris
10024859 Arthroderma gypseum CBS 118893
114663 Mus musculus
282636 Rattus norvegicus
3613 Homo sapiens
511124 Bos taurus

Protein level used designations for IMPA2

  • inositol(myo)-1(or 4)-monophosphatase 2
  • inositol monophosphatase 2
  • IMP 2
  • IMPase 2
  • inositol-1(or 4)-monophosphatase 2
  • myo-inositol monophosphatase A2
  • inosine monophosphatase 2
  • inositol monophosphatase 2 variant 1
  • inositol monophosphatase 2 variant 2
Other products related to IMPA2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com