JAM3 (Junctional Adhesion Molecule 3, JAM3)

Short Description: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is localized in the tight junctions between high endothelial cells. Unlike other proteins in this family, the this protein is unable to adhere to leukocyte cell lines and only forms weak homotypic interactions. The encoded protein is a member of the junctional adhesion molecule protein family and acts as a receptor for another member of this family. A mutation in an intron of this gene is associated with hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011].
More information related to gene JAM3.
Products related to JAM3 Gene:
Type
  • 115
  • 5
Species
  • 48
  • 40
  • 28
  • 2
  • 2
Application
  • 75
  • 26
  • 21
  • 16
  • 2
Fusion tag
  • 39
  • 14
  • 13
  • 11
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 52
  • 35
  • 12
  • 9
  • 5
Insert
  • 44
  • 37
  • 18
  • 8
  • 6
Oligo-Type
  • 3
  • 2
Resistance Gene
  • 50
  • 41
  • 20
  • 4
  • 2
Expression Type
  • 90
  • 48
  • 21
Selectable Marker
  • 26
  • 23
  • 21
Promoter
  • 31
  • 31
  • 28
  • 13
  • 8
Format
  • 56
  • 27
  • 22
  • 15
120 Products

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Junctional Adhesion Molecule 3 (JAM3)
Gene ID:
569217 (Zebrafish (Danio rerio), JAM3)
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4079932
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Junctional Adhesion Molecule 3 (JAM3)
Gene ID:
83964 (Mouse (Murine), JAM3)
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827801
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Junctional Adhesion Molecule 3 (JAM3)
Gene ID:
513412 (Cow (Bovine), JAM3)
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3858370
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Junctional Adhesion Molecule 3 (JAM3)
Gene ID:
83700 (Human, JAM3)
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4093582
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Junctional Adhesion Molecule 3 (JAM3)
Gene ID:
315509 (Rat (Rattus), JAM3)
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053692
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Junctional Adhesion Molecule 3 (JAM3)
NCBI Accession:
NM_023277
Species:
Mouse (Murine)
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561371
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Junctional Adhesion Molecule 3
Species:
Mouse (Murine)
Synonyms:
JAM3, jam3, sr:nyz155, wu:fb30h11, wu:fc08c06, wu:fc13e04, wu:fc25g11, jamc.2, 1110002N23Rik, JAM-3, JAM-C, Jcam3, JAM-2, JAMC
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193649
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Junctional Adhesion Molecule 3
Species:
Human
Synonyms:
JAM3, jam3, sr:nyz155, wu:fb30h11, wu:fc08c06, wu:fc13e04, wu:fc25g11, jamc.2, 1110002N23Rik, JAM-3, JAM-C, Jcam3, JAM-2, JAMC
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190043
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Junctional Adhesion Molecule 3 (JAM3)
Gene ID:
569217 (Zebrafish (Danio rerio), JAM3)
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4079933
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Junctional Adhesion Molecule 3 (JAM3)
Gene ID:
83964 (Mouse (Murine), JAM3)
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827799
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Junctional Adhesion Molecule 3 (JAM3)
Gene ID:
513412 (Cow (Bovine), JAM3)
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3858369
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Junctional Adhesion Molecule 3 (JAM3)
Gene ID:
83700 (Human, JAM3)
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4093583
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Junctional Adhesion Molecule 3 (JAM3)
Gene ID:
315509 (Rat (Rattus), JAM3)
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053693
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Junctional Adhesion Molecule 3 (JAM3)
NCBI Accession:
NM_001205329
Gene ID:
83700 (Human, JAM3)
Synonyms:
JAM3, jam3b, jam3a, Jam3
Insert length:
780 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4928298
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Junctional Adhesion Molecule 3 (JAM3)
NCBI Accession:
NM_032801
Species:
Human
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913415
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Junctional Adhesion Molecule 3 (JAM3)
NCBI Accession:
NM_032801
Species:
Human
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913417
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Junctional Adhesion Molecule 3 (JAM3)
NCBI Accession:
NM_032801
Species:
Human
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913418
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Junctional Adhesion Molecule 3 (JAM3)
NCBI Accession:
NM_032801
Species:
Human
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913419
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Junctional Adhesion Molecule 3 (JAM3)
NCBI Accession:
NM_032801
Species:
Human
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913420
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Junctional Adhesion Molecule 3 (JAM3)
NCBI Accession:
NM_032801
Species:
Human
Synonyms:
JAM3, jam3b, jam3a, Jam3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913421
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to JAM3

  • junctional adhesion molecule 3 (JAM3)
  • junctional adhesion molecule 3b (jam3b)
  • junctional adhesion molecule 3a (jam3a)
  • junction adhesion molecule 3 (Jam3)
  • junctional adhesion molecule 3 (Jam3)
  • 1110002N23Rik
  • JAM-2
  • JAM-3
  • JAM-C
  • JAM3
  • jam3
  • JAMC
  • jamc.2
  • Jcam3
  • sr:nyz155
  • wu:fb30h11
  • wu:fc08c06
  • wu:fc13e04
  • wu:fc25g11

Gene-IDs for different species

GENE IDSPECIES
419736 Gallus gallus
451678 Pan troglodytes
569217 Danio rerio
797651 Danio rerio
83964 Mus musculus
83700 Homo sapiens
489271 Canis lupus familiaris
513412 Bos taurus
315509 Rattus norvegicus

Protein level used designations for JAM3

  • junctional adhesion molecule 3
  • jamc
  • jamc.1
  • si:ch211-277g22.3
  • JAM-C-like protein
  • junction cell adhesion molecule 3
  • junction cell adhesion molecule C
  • junctional adhesion molecule C
  • JAM-3
  • JAM-C
Other products related to JAM3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com