Kallikrein 1 (Kallikrein 1, KLK1)

Short Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. This protein is functionally conserved in its capacity to release the vasoactive peptide, Lys-bradykinin, from low molecular weight kininogen. [provided by RefSeq, Jul 2008].
More information related to gene Kallikrein 1.
Products related to Kallikrein 1 Gene:
  • 116
  • 5
  • 51
  • 44
  • 24
  • 2
  • 78
  • 30
  • 17
  • 16
  • 2
Fusion tag
  • 44
  • 13
  • 11
  • 10
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
  • 52
  • 35
  • 12
  • 6
  • 5
  • 46
  • 40
  • 14
  • 8
  • 6
  • 3
  • 2
Resistance Gene
  • 51
  • 42
  • 18
  • 5
  • 2
Expression Type
  • 86
  • 43
  • 22
Selectable Marker
  • 22
  • 22
  • 21
  • 1
  • 37
  • 28
  • 24
  • 13
  • 8
  • 52
  • 27
  • 22
  • 20
121 Products

Kallikrein 1 (KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Insert length:
789 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5735131
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
Kallikrein 1 (KLK1)
NCBI Accession:
KLK1, klk1.L, LOC100101620, Klk1
Insert length:
789 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5383814
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression, Cloning
Kallikrein 1 (KLK1)
Gene ID:
493738 (Cow (Bovine), KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3852689
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Kallikrein 1 (KLK1)
Gene ID:
3816 (Human, KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4034943
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Kallikrein 1 (KLK1)
Gene ID:
24594 (Rat (Rattus), KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4045442
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Kallikrein 1 (KLK1)
Gene ID:
16612 (Mouse (Murine), KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4215690
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Kallikrein 1 (KLK1)
Gene ID:
16612 (Mouse (Murine), KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4215689
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Kallikrein 1 (KLK1)
Gene ID:
16612 (Mouse (Murine), KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4215691
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Kallikrein 1 (KLK1)
NCBI Accession:
Mouse (Murine)
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3561486
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Kallikrein 1 (KLK1)
NCBI Accession:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47 and RV-M
Catalog No. ABIN3561487
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
Kallikrein 1
Mouse (Murine)
KLKR, Klk6, hK1, klkr, kallikrein, 0610007D04Rik, Kal, Klk1b6, mGk-6
-20 °C
Catalog No. ABIN3194440
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
Kallikrein 1
KLKR, Klk6, hK1, klkr, kallikrein, 0610007D04Rik, Kal, Klk1b6, mGk-6
-20 °C
Catalog No. ABIN3188772
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Protein Expression, Cloning
Kallikrein 1 (KLK1)
Gene ID:
493738 (Cow (Bovine), KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3852687
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Kallikrein 1 (KLK1)
Gene ID:
3816 (Human, KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4034944
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Kallikrein 1 (KLK1)
Gene ID:
24594 (Rat (Rattus), KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4045443
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Kallikrein 1 (KLK1)
Gene ID:
16612 (Mouse (Murine), KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4215688
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Kallikrein 1 (KLK1)
Gene ID:
16612 (Mouse (Murine), KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4215693
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Kallikrein 1 (KLK1)
Gene ID:
16612 (Mouse (Murine), KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4215694
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Kallikrein 1 (KLK1)
Gene ID:
3816 (Human, KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Insert length:
789 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5313347
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Kallikrein 1 (KLK1)
KLK1, klk1.L, LOC100101620, Klk1
Insert length:
789 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4438433
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to Kallikrein 1

  • kallikrein 1 (KLK1)
  • kallikrein 1 L homeolog (klk1.L)
  • kallikrein 1 (LOC100101620)
  • kallikrein 1 (Klk1)
  • 0610007D04Rik
  • hK1
  • Kal
  • kallikrein
  • Klk1b6
  • Klk6
  • KLKR
  • klkr
  • mGk-6

Gene-IDs for different species

3816 Homo sapiens
493738 Bos taurus
495211 Xenopus laevis
100048991 Ovis aries
100101620 Oryctolagus cuniculus
403942 Canis lupus familiaris
431673 Sus scrofa
16612 Mus musculus
100717905 Cavia porcellus

Protein level used designations for Kallikrein 1

  • glandular kallikrein 1
  • kallikrein 1, renal/pancreas/salivary
  • kallikrein serine protease 1
  • kallikrein-1
  • kidney/pancreas/salivary gland kallikrein
  • tissue kallikrein
  • kallikrein 1
  • glandular kallikrein
  • KAL-B
  • glandular kallikrein K1
  • kallikrein 6
  • kallikrein renal/pancreas/salivary
  • renal kallikrein
  • tissue kallikrein-6
  • true tissue kallikrein
Other products related to Kallikrein 1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com