Kallikrein 1 (Kallikrein 1, KLK1)

Short Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. This protein is functionally conserved in its capacity to release the vasoactive peptide, Lys-bradykinin, from low molecular weight kininogen. [provided by RefSeq, Jul 2008].
More information related to gene Kallikrein 1.
Products related to Kallikrein 1 Gene:
125 Products
Type
  • 118
  • 7
Species
  • 53
  • 46
  • 24
  • 2
Application
  • 78
  • 30
  • 21
  • 16
  • 2
Fusion tag
  • 46
  • 13
  • 13
  • 10
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 54
  • 35
  • 12
  • 6
  • 5
Insert
  • 46
  • 40
  • 16
  • 8
  • 6
Oligo-Type
  • 5
  • 2
Resistance Gene
  • 53
  • 42
  • 18
  • 5
  • 2
Expression Type
  • 88
  • 45
  • 22
Selectable Marker
  • 23
  • 22
  • 22
  • 1
Promoter
  • 37
  • 30
  • 26
  • 13
  • 8
Format
  • 56
  • 27
  • 22
  • 20

Type:
ORF
Application:
Protein Expression
Gene:
Kallikrein 1 (KLK1)
NCBI Accession:
NM_002257,NP_002248
Species:
Human
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Insert length:
789 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5383814
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kallikrein 1 (KLK1)
Gene ID:
493738 (Cow (Bovine), KLK1)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3852689
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kallikrein 1 (KLK1)
Gene ID:
24594 (Rat (Rattus), KLK1)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045442
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kallikrein 1 (KLK1)
Gene ID:
3816 (Human, KLK1)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034943
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kallikrein 1 (KLK1)
Gene ID:
16612 (Mouse (Murine), KLK1)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215689
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kallikrein 1 (KLK1)
Gene ID:
16612 (Mouse (Murine), KLK1)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215691
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kallikrein 1 (KLK1)
Gene ID:
16612 (Mouse (Murine), KLK1)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215690
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kallikrein 1 (KLK1)
NCBI Accession:
NM_002257
Species:
Human
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561487
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kallikrein 1 (KLK1)
NCBI Accession:
NM_010639
Species:
Mouse (Murine)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561486
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Kallikrein 1
Species:
Human
Synonyms:
KLKR, Klk6, hK1, klkr, kallikrein, 0610007D04Rik, Kal, Klk1b6, mGk-6
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188772
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Kallikrein 1
Species:
Mouse (Murine)
Synonyms:
KLKR, Klk6, hK1, klkr, kallikrein, 0610007D04Rik, Kal, Klk1b6, mGk-6
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194440
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Kallikrein 1 (KLK1)
Species:
Human
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Insert length:
789 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5735131
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kallikrein 1 (KLK1)
Gene ID:
493738 (Cow (Bovine), KLK1)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3852687
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kallikrein 1 (KLK1)
Gene ID:
24594 (Rat (Rattus), KLK1)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045443
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kallikrein 1 (KLK1)
Gene ID:
3816 (Human, KLK1)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034944
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kallikrein 1 (KLK1)
Gene ID:
16612 (Mouse (Murine), KLK1)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215688
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kallikrein 1 (KLK1)
Gene ID:
16612 (Mouse (Murine), KLK1)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215693
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kallikrein 1 (KLK1)
Gene ID:
16612 (Mouse (Murine), KLK1)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215694
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Kallikrein 1 (KLK1)
Gene ID:
3816 (Human, KLK1)
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Insert length:
789 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5313347
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Kallikrein 1 (KLK1)
NCBI Accession:
NM_002257,NP_002248
Species:
Human
Synonyms:
KLK1, klk1.L, LOC100101620, Klk1
Insert length:
897 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3390465
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to Kallikrein 1

  • kallikrein 1 (KLK1)
  • kallikrein 1 L homeolog (klk1.L)
  • kallikrein 1 (LOC100101620)
  • kallikrein 1 (Klk1)
  • 0610007D04Rik
  • hK1
  • Kal
  • kallikrein
  • Klk1b6
  • Klk6
  • KLKR
  • klkr
  • mGk-6

Gene-IDs for different species

GENE IDSPECIES
3816 Homo sapiens
493738 Bos taurus
495211 Xenopus laevis
100048991 Ovis aries
100101620 Oryctolagus cuniculus
403942 Canis lupus familiaris
431673 Sus scrofa
16612 Mus musculus
100717905 Cavia porcellus

Protein level used designations for Kallikrein 1

  • glandular kallikrein 1
  • kallikrein 1, renal/pancreas/salivary
  • kallikrein serine protease 1
  • kallikrein-1
  • kidney/pancreas/salivary gland kallikrein
  • tissue kallikrein
  • kallikrein 1
  • glandular kallikrein
  • KAL-B
  • glandular kallikrein K1
  • kallikrein 6
  • kallikrein renal/pancreas/salivary
  • renal kallikrein
  • tissue kallikrein-6
  • true tissue kallikrein
Other products related to Kallikrein 1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com