KCNQ1 (Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1, KCNQ1)

Short Description: This gene encodes a voltage-gated potassium channel required for repolarization phase of the cardiac action potential. This protein can form heteromultimers with two other potassium channel proteins, KCNE1 and KCNE3. Mutations in this gene are associated with hereditary long QT syndrome 1 (also known as Romano-Ward syndrome), Jervell and Lange-Nielsen syndrome, and familial atrial fibrillation. This gene exhibits tissue-specific imprinting, with preferential expression from the maternal allele in some tissues, and biallelic expression in others. This gene is located in a region of chromosome 11 amongst other imprinted genes that are associated with Beckwith-Wiedemann syndrome (BWS), and itself has been shown to be disrupted by chromosomal rearrangements in patients with BWS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011].
More information related to gene KCNQ1.
Products related to KCNQ1 Gene:
122 Products
Data Quality
  • 2
Type
  • 115
  • 7
Species
  • 61
  • 31
  • 28
  • 2
Application
  • 71
  • 27
  • 25
  • 16
  • 1
Fusion tag
  • 41
  • 19
  • 13
  • 11
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 43
  • 40
  • 14
  • 9
  • 5
Insert
  • 40
  • 38
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 47
  • 40
  • 22
  • 6
  • 2
Expression Type
  • 98
  • 51
  • 11
Selectable Marker
  • 28
  • 26
  • 11
  • 1
Promoter
  • 37
  • 31
  • 23
  • 15
  • 8
Format
  • 54
  • 29
  • 24
  • 15

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Gene ID:
557498 (Zebrafish (Danio rerio), KCNQ1)
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3878262
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Gene ID:
16535 (Mouse (Murine), KCNQ1)
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809319
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Gene ID:
16535 (Mouse (Murine), KCNQ1)
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875401
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Gene ID:
3784 (Human, KCNQ1)
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999581
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Species:
Human
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3888437
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1
Species:
Human
Synonyms:
ATFB1, ATFB3, JLNS1, KCNA8, KCNA9, KVLQT1, Kv1.9, Kv7.1, LQT, LQT1, RWS, SQT2, WRS, CG12215, CG12915, CG33135, DKCNQ, Dmel\\CG33135, dKCNQ, kcnq1, KCNQ1, kqt-3, kv7.1, Kvlqt1, KvLQT-1, kcnq1-A, xkvlqt1, zgc:158384, AW559127, Kcna9, KvLQT1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190976
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Gene ID:
557498 (Zebrafish (Danio rerio), KCNQ1)
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3865257
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Gene ID:
16535 (Mouse (Murine), KCNQ1)
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809320
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Gene ID:
16535 (Mouse (Murine), KCNQ1)
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809322
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Gene ID:
3784 (Human, KCNQ1)
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999580
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Gene ID:
3784 (Human, KCNQ1)
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Insert length:
1650 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5324618
$199.17
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Species:
Human
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5772714
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Species:
Human
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5772713
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Species:
Human
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913866
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Species:
Human
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913870
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Species:
Human
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913871
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Species:
Human
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913872
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Species:
Human
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913862
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Species:
Human
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913864
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1)
Species:
Human
Synonyms:
KCNQ1, KCNQ, kcnq1, Kcnq1, kcnq1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913868
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to KCNQ1

  • potassium voltage-gated channel subfamily Q member 1 (KCNQ1)
  • KCNQ potassium channel (KCNQ)
  • potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1)
  • potassium channel, voltage gated KQT-like subfamily Q, member 1 (kcnq1)
  • voltage gated potassium channel subunit (kcnq1)
  • potassium voltage-gated channel subfamily Q member 1 (Kcnq1)
  • potassium channel, voltage gated KQT-like subfamily Q, member 1 L homeolog (kcnq1.L)
  • potassium voltage-gated channel, KQT-like subfamily, member 1 (kcnq1)
  • potassium voltage-gated channel, subfamily Q, member 1 (Kcnq1)
  • ATFB1
  • ATFB3
  • AW559127
  • CG12215
  • CG12915
  • CG33135
  • DKCNQ
  • dKCNQ
  • Dmel\\CG33135
  • JLNS1
  • KCNA8
  • Kcna9
  • KCNA9
  • KCNQ1
  • kcnq1
  • kcnq1-A
  • kqt-3
  • Kv1.9
  • Kv7.1
  • kv7.1
  • KvLQT-1
  • KVLQT1
  • Kvlqt1
  • KvLQT1
  • LQT
  • LQT1
  • RWS
  • SQT2
  • WRS
  • xkvlqt1
  • zgc:158384

Gene-IDs for different species

GENE IDSPECIES
3784 Homo sapiens
36071 Drosophila melanogaster
397326 Sus scrofa
483669 Canis lupus familiaris
100009443 Oryctolagus cuniculus
100034129 Equus caballus
100145329 Xenopus (Silurana) tropicalis
100187466 Ciona intestinalis
84020 Rattus norvegicus
373746 Xenopus laevis
423090 Gallus gallus
557498 Danio rerio
784876 Bos taurus
16535 Mus musculus
100379230 Cavia porcellus
101092644 Felis catus

Protein level used designations for KCNQ1

  • IKs producing slow voltage-gated potassium channel subunit alpha KvLQT1
  • kidney and cardiac voltage dependend K+ channel
  • potassium voltage-gated channel subfamily KQT member 1
  • slow delayed rectifier channel subunit
  • voltage-gated potassium channel subunit Kv7.1
  • CG33135-PC
  • CG33135-PD
  • CG33135-PE
  • CG33135-PF
  • CG33135-PG
  • CG33135-PH
  • CG33135-PI
  • CG33135-PJ
  • CG33135-PK
  • KCNQ-PC
  • KCNQ-PD
  • KCNQ-PE
  • KCNQ-PF
  • KCNQ-PG
  • KCNQ-PH
  • KCNQ-PI
  • KCNQ-PJ
  • KCNQ-PK
  • KCNQ-type K[+] channel
  • Potassium voltage-gated channel subfamily KQT member 1
  • potassium channel protein (KvLQT1)
  • ventricular voltage-gated K+ channel pore-forming subunit KCNQ1
  • KvLQT1 voltage-gated delayed rectifier potassium channel
  • potassium voltage-gated channel, KQT-like subfamily, member 1
  • potassium channel protein KCNQ1
  • potassium voltage-gated channel, subfamily Q, member 1
  • voltage gated potassium channel subunit
  • KQT-like 1
  • IKs producing slow voltage-gated potassium channel subunit alpha xKvLQT1
  • Voltage-gated potassium channel subunit Kv7.1
  • potassium channel protein
Other products related to KCNQ1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com