KIRREL3 (Kin of IRRE Like 3 (Drosophila), KIRREL3)

Short Description: The protein encoded by this gene is a member of the nephrin-like protein family. These proteins are expressed in fetal and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of these proteins interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in this gene are associated with mental retardation autosomal dominant type 4 (MRD4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009].
More information related to gene KIRREL3.
Products related to KIRREL3 Gene:
174 Products
Type
  • 167
  • 7
Species
  • 87
  • 46
  • 39
  • 2
Application
  • 101
  • 44
  • 25
  • 16
  • 2
Fusion tag
  • 48
  • 25
  • 23
  • 21
  • 9
Vector Backbone
  • 15
  • 15
  • 12
  • 7
  • 7
Vector
  • 63
  • 53
  • 28
  • 13
  • 9
Insert
  • 74
  • 57
  • 20
  • 8
  • 6
Oligo-Type
  • 5
  • 2
Resistance Gene
  • 83
  • 41
  • 36
  • 7
  • 2
Expression Type
  • 149
  • 67
  • 11
Selectable Marker
  • 53
  • 26
  • 11
Promoter
  • 69
  • 30
  • 29
  • 24
  • 8
Format
  • 69
  • 63
  • 30
  • 12

Type:
cDNA
Application:
Cloning
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
Gene ID:
67703 (Mouse (Murine), KIRREL3)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4100852
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
Gene ID:
618028 (Cow (Bovine), KIRREL3)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3867720
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
Gene ID:
84623 (Human, KIRREL3)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4010007
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
Gene ID:
84623 (Human, KIRREL3)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4010008
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
NCBI Accession:
NM_001048215
Species:
Rat (Rattus)
Synonyms:
KIRREL3, Kirrel3
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3888450
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Kin of IRRE Like 3 (Drosophila)
Species:
Mouse (Murine)
Synonyms:
KIRRE, MRD4, NEPH2, PRO4502, 1500010O20Rik, 2900036G11Rik, SST4, mKIAA1867
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193918
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Kin of IRRE Like 3 (Drosophila)
Species:
Rat (Rattus)
Synonyms:
KIRRE, MRD4, NEPH2, PRO4502, 1500010O20Rik, 2900036G11Rik, SST4, mKIAA1867
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196379
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
Gene ID:
67703 (Mouse (Murine), KIRREL3)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4100853
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
Gene ID:
618028 (Cow (Bovine), KIRREL3)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3867722
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
Gene ID:
84623 (Human, KIRREL3)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4010009
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
Gene ID:
84623 (Human, KIRREL3)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4010010
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
NCBI Accession:
NM_001048215
Species:
Rat (Rattus)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3914446
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
NCBI Accession:
NM_001048215
Species:
Rat (Rattus)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3914451
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
NCBI Accession:
NM_001048215
Species:
Rat (Rattus)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3914452
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
NCBI Accession:
NM_001048215
Species:
Rat (Rattus)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3914450
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
NCBI Accession:
NM_001048215
Species:
Rat (Rattus)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3914449
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
NCBI Accession:
NM_001048215
Species:
Rat (Rattus)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3914448
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
NCBI Accession:
NM_001048215
Species:
Rat (Rattus)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3914442
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
NCBI Accession:
NM_001048215
Species:
Rat (Rattus)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3914445
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Kin of IRRE Like 3 (Drosophila) (KIRREL3)
NCBI Accession:
NM_001048215
Species:
Rat (Rattus)
Synonyms:
KIRREL3, Kirrel3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3914444
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to KIRREL3

  • kirre like nephrin family adhesion molecule 3 (KIRREL3)
  • kin of IRRE like 3 (Drosophila) (Kirrel3)
  • kin of IRRE like 3 (Drosophila) (KIRREL3)
  • kirre like nephrin family adhesion molecule 3 (Kirrel3)
  • 1500010O20Rik
  • 2900036G11Rik
  • KIRRE
  • mKIAA1867
  • MRD4
  • NEPH2
  • PRO4502
  • SST4

Gene-IDs for different species

GENE IDSPECIES
489289 Canis lupus familiaris
84623 Homo sapiens
67703 Mus musculus
419719 Gallus gallus
315546 Rattus norvegicus

Protein level used designations for KIRREL3

  • kin of IRRE like 3 (Drosophila)
  • kin of IRRE-like protein 3
  • kin of irregular chiasm-like protein 3
  • nephrin-like 2
  • nephrin-like protein 2
  • X kin of IRRE like 3
  • membrane protein mKirre
Other products related to KIRREL3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com