KIT Ligand (KIT Ligand, KITLG)

Short Description: This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene KIT Ligand.
Products related to KIT Ligand Gene:
164 Products
Data Quality
  • 1
Type
  • 158
  • 6
Species
  • 68
  • 42
  • 38
  • 12
  • 2
Application
  • 102
  • 39
  • 23
  • 16
  • 2
Fusion tag
  • 53
  • 21
  • 18
  • 16
  • 10
Vector Backbone
  • 10
  • 10
  • 6
  • 6
  • 6
Vector
  • 72
  • 42
  • 16
  • 13
  • 9
Insert
  • 66
  • 57
  • 19
  • 8
  • 6
Oligo-Type
  • 4
  • 2
Resistance Gene
  • 74
  • 54
  • 26
  • 4
  • 2
Expression Type
  • 107
  • 54
  • 33
  • 2
Selectable Marker
  • 37
  • 33
  • 24
  • 1
Promoter
  • 47
  • 46
  • 31
  • 18
  • 8
Format
  • 82
  • 33
  • 25
  • 24

Type:
ORF
Application:
Protein Expression
Gene:
KIT Ligand (KITLG)
NCBI Accession:
NM_003994,NP_003985
Species:
Human
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Insert length:
738 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5353678
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
379817 (Xenopus laevis, KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843125
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
17311 (Mouse (Murine), KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809602
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
733847 (Xenopus tropicalis, KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031016
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
4254 (Human, KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999745
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
4254 (Human, KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999747
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
4254 (Human, KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999746
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
4254 (Human, KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4095404
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
4254 (Human, KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4095403
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
4254 (Human, KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4095405
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
KIT Ligand (KITLG)
NCBI Accession:
NM_001012735
Species:
Dog (Canine)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561454
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
KIT Ligand (KITLG)
NCBI Accession:
NM_000899
Species:
Human
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561455
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
KIT Ligand (KITLG)
NCBI Accession:
NM_013598
Species:
Mouse (Murine)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561456
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
KIT Ligand
Species:
Human
Synonyms:
Xkl-1, Xsl, Xsl-1, Xsl-2, steel, KITLG, SCF, kitl, kl-1, mgf, scf, FPH2, KL-1, Kitl, MGF, SF, SHEP7, Clo, Con, Gb, Kitlg, Mgf, SLF, Sl, blz, contrasted, 710-712, CSF, KITL
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188815
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
KIT Ligand
Species:
Mouse (Murine)
Synonyms:
Xkl-1, Xsl, Xsl-1, Xsl-2, steel, KITLG, SCF, kitl, kl-1, mgf, scf, FPH2, KL-1, Kitl, MGF, SF, SHEP7, Clo, Con, Gb, Kitlg, Mgf, SLF, Sl, blz, contrasted, 710-712, CSF, KITL
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194037
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
379817 (Xenopus laevis, KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843126
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
17311 (Mouse (Murine), KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809603
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
733847 (Xenopus tropicalis, KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031015
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
4254 (Human, KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999748
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
KIT Ligand (KITLG)
Gene ID:
4254 (Human, KITLG)
Synonyms:
kitlg.L, KITLG, kitlg, Kitl, Kitlg
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999750
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to KIT Ligand

  • KIT ligand L homeolog (kitlg.L)
  • KIT ligand (KITLG)
  • KIT ligand (kitlg)
  • kit ligand (Kitl)
  • KIT ligand (Kitlg)
  • 710-712
  • blz
  • Clo
  • Con
  • contrasted
  • CSF
  • FPH2
  • Gb
  • KITL
  • kitl
  • Kitl
  • KITLG
  • Kitlg
  • kl-1
  • KL-1
  • Mgf
  • MGF
  • mgf
  • scf
  • SCF
  • SF
  • SHEP7
  • Sl
  • SLF
  • steel
  • Xkl-1
  • Xsl
  • Xsl-1
  • Xsl-2

Gene-IDs for different species

GENE IDSPECIES
379817 Xenopus laevis
452114 Pan troglodytes
574254 Macaca mulatta
733847 Xenopus (Silurana) tropicalis
4254 Homo sapiens
17311 Mus musculus
60427 Rattus norvegicus
396028 Gallus gallus
403507 Canis lupus familiaris
397509 Sus scrofa
281885 Bos taurus
100860807 Capra hircus
100034127 Equus caballus
493937 Felis catus
443371 Ovis aries

Protein level used designations for KIT Ligand

  • KIT ligand
  • c-Kit ligand
  • familial progressive hyperpigmentation 2
  • kit ligand
  • mast cell growth factor
  • steel factor
  • stem cell factor
  • C-kit ligand
  • Steel factor
  • cloud gray
  • grizzle-belly
  • hematopoietic growth factor KL
  • steel factor/kit ligand
  • stem cell factor KL-1
  • KIT ligand precursor form 1
  • KIT ligand precursor form 4
  • MGF
  • SCF
  • c-kit ligand
  • stem cell factor, CSF
  • mast cell growth factor (white heifer disease)
  • Mast cell growth factor
  • stem cell factor homolog
Other products related to KIT Ligand such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com