KPNA4 (Karyopherin (Importin) alpha 4, KPNA4)

Short Description: The nuclear import of karyophilic proteins is directed by short amino acid sequences termed nuclear localization signals (NLSs). Karyopherins, or importins, are cytoplasmic proteins that recognize NLSs and dock NLS-containing proteins to the nuclear pore complex. The protein encoded by this gene shares the sequence similarity with Xenopus importin-alpha and Saccharomyces cerevisiae Srp1. This protein is found to interact with the NLSs of DNA helicase Q1 and SV40 T antigen. [provided by RefSeq, Jul 2008].
More information related to gene KPNA4.
Products related to KPNA4 Gene:
128 Products
Data Quality
  • 1
Type
  • 122
  • 6
Species
  • 67
  • 32
  • 26
  • 2
  • 1
Application
  • 71
  • 34
  • 25
  • 16
  • 1
Fusion tag
  • 46
  • 15
  • 14
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 47
  • 36
  • 16
  • 9
  • 8
Insert
  • 47
  • 39
  • 20
  • 8
  • 6
Oligo-Type
  • 5
  • 1
Resistance Gene
  • 55
  • 42
  • 18
  • 7
  • 2
Expression Type
  • 99
  • 53
  • 13
Selectable Marker
  • 28
  • 26
  • 13
  • 1
Promoter
  • 34
  • 30
  • 25
  • 17
  • 8
Format
  • 51
  • 36
  • 22
  • 19

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Gene ID:
327373 (Zebrafish (Danio rerio), KPNA4)
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4072757
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Gene ID:
16649 (Mouse (Murine), KPNA4)
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809355
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Gene ID:
16649 (Mouse (Murine), KPNA4)
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875408
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Gene ID:
432010 (Xenopus laevis, KPNA4)
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3848485
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Gene ID:
3840 (Human, KPNA4)
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211166
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Gene ID:
3840 (Human, KPNA4)
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211165
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Species:
Human
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561518
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Karyopherin (Importin) alpha 4
Species:
Human
Synonyms:
IPOA3, QIP1, SRP3, 6, ATIMPALPHA3, IMPA-3, IMPORTIN ALPHA 3, IMPORTIN ALPHA ISOFORM 3, MODIFIER OF SNC1, T10M13.16, T10M13_16, LOC100224013, 1110058D08Rik, importin, ipoa3, qip1, srp3, impa3, wu:fa56d07, wu:fa66g10, wu:fe14c04, wu:fi04h11, wu:fi19b05
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191961
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Species:
Human
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Insert length:
1566 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751281
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Species:
Human
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Insert length:
231 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751282
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Gene ID:
16649 (Mouse (Murine), KPNA4)
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809353
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Gene ID:
16649 (Mouse (Murine), KPNA4)
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809356
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Gene ID:
432010 (Xenopus laevis, KPNA4)
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3848486
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Gene ID:
3840 (Human, KPNA4)
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211167
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Gene ID:
3840 (Human, KPNA4)
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211164
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Gene ID:
3840 (Human, KPNA4)
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Insert length:
231 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318852
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Cloning
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Gene ID:
3840 (Human, KPNA4)
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Insert length:
1566 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318393
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
NCBI Accession:
NM_002268,NP_002259
Species:
Human
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Insert length:
4040 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ao, Danappa Jayappa, Wang, Zheng, Kung, Rassart, Depping, Kohler, Cohen, Yao: "Importin alpha3 interacts with HIV-1 integrase and contributes to HIV-1 nuclear import and replication." in: Journal of virology, Vol. 84, Issue 17, pp. 8650-63, 2010 (Pubmed)
  • Theiss, Jenkins, Okoro, Klapproth, Merlin, Sitaraman: "Prohibitin inhibits tumor necrosis factor alpha-induced nuclear factor-kappa B nuclear translocation via the novel mechanism of decreasing importin alpha3 expression." in: Molecular biology of the cell, Vol. 20, Issue 20, pp. 4412-23, 2009 (Pubmed)
Catalog No. ABIN3384784
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Species:
Human
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Insert length:
1566 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4477367
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Karyopherin (Importin) alpha 4 (KPNA4)
Species:
Human
Synonyms:
KPNA4, MOS6, LOC100533341, Kpna4, kpna4.S, kpna4
Insert length:
1566 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4477368
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to KPNA4

  • karyopherin subunit alpha 4 (KPNA4)
  • ARM repeat superfamily protein (MOS6)
  • importin alpha 3 (LOC100533341)
  • karyopherin (importin) alpha 4 (Kpna4)
  • karyopherin subunit alpha 4 (Kpna4)
  • karyopherin alpha 4 (importin alpha 3) S homeolog (kpna4.S)
  • karyopherin alpha 4 (importin alpha 3) (kpna4)
  • 6
  • 1110058D08Rik
  • ATIMPALPHA3
  • IMPA-3
  • impa3
  • importin
  • IMPORTIN ALPHA 3
  • IMPORTIN ALPHA ISOFORM 3
  • IPOA3
  • ipoa3
  • LOC100224013
  • MODIFIER OF SNC1
  • QIP1
  • qip1
  • srp3
  • SRP3
  • T10M13.16
  • T10M13_16
  • wu:fa56d07
  • wu:fa66g10
  • wu:fe14c04
  • wu:fi04h11
  • wu:fi19b05

Gene-IDs for different species

GENE IDSPECIES
3840 Homo sapiens
827472 Arabidopsis thaliana
100533341 Aplysia californica
100224013 Taeniopygia guttata
16649 Mus musculus
361959 Rattus norvegicus
432010 Xenopus laevis
425012 Gallus gallus
478680 Canis lupus familiaris
535090 Bos taurus
100729008 Cavia porcellus
327373 Danio rerio

Protein level used designations for KPNA4

  • importin alpha Q1
  • importin subunit alpha-3
  • importin subunit alpha-4
  • karyopherin subunit alpha-4
  • importin alpha 3
  • karyopherin alpha 4 (importin alpha 3)
  • qip1
  • karyopherin (importin) alpha 4
  • predicted role in nuclear import
Other products related to KPNA4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com