KREMEN1 (Kringle Containing Transmembrane Protein 1, KREMEN1)

Short Description: This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor that functionally cooperates with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein is a component of a membrane complex that modulates canonical WNT signaling through lipoprotein receptor-related protein 6 (LRP6). It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008].
More information related to gene KREMEN1.
Products related to KREMEN1 Gene:
125 Products
Type
  • 119
  • 6
Species
  • 59
  • 34
  • 28
  • 2
  • 2
Application
  • 72
  • 28
  • 27
  • 16
Fusion tag
  • 44
  • 21
  • 15
  • 11
  • 8
Vector Backbone
  • 9
  • 9
  • 6
  • 6
  • 6
Vector
  • 47
  • 41
  • 12
  • 9
  • 9
Insert
  • 43
  • 39
  • 21
  • 8
  • 6
Oligo-Type
  • 6
Resistance Gene
  • 46
  • 46
  • 24
  • 3
  • 2
Expression Type
  • 101
  • 51
  • 11
Selectable Marker
  • 31
  • 26
  • 11
Promoter
  • 40
  • 31
  • 23
  • 15
  • 8
Format
  • 58
  • 27
  • 24
  • 16

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
Gene ID:
100144698 (Xenopus tropicalis, KREMEN1)
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873584
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
Gene ID:
83999 (Human, KREMEN1)
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827830
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
Gene ID:
84035 (Mouse (Murine), KREMEN1)
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4009923
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
Gene ID:
84035 (Mouse (Murine), KREMEN1)
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4009924
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
NCBI Accession:
NM_032045
Species:
Human
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561524
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
Gene ID:
100144698 (Xenopus tropicalis, KREMEN1)
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873583
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
Gene ID:
83999 (Human, KREMEN1)
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827831
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
Gene ID:
84035 (Mouse (Murine), KREMEN1)
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4009922
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
Gene ID:
84035 (Mouse (Murine), KREMEN1)
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4009921
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
Species:
Human
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Insert length:
1377 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4705102
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
Species:
Human
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Insert length:
1377 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4834232
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
NCBI Accession:
NM_001039570,NP_001034659
Species:
Human
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Insert length:
1428 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5353709
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Kringle Containing Transmembrane Protein 1
Species:
Mouse (Murine)
Synonyms:
KREMEN1, krm1, kremen, kremem1, KREMEN, KRM1, AV002070, Kremen, Krm1, si:ct737139.1, si:dkeyp-7c9.1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Kremen1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3271368
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Kringle Containing Transmembrane Protein 1
Species:
Rat (Rattus)
Synonyms:
KREMEN1, krm1, kremen, kremem1, KREMEN, KRM1, AV002070, Kremen, Krm1, si:ct737139.1, si:dkeyp-7c9.1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Kremen1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3353169
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Kringle Containing Transmembrane Protein 1
Species:
Human
Synonyms:
KREMEN1, krm1, kremen, kremem1, KREMEN, KRM1, AV002070, Kremen, Krm1, si:ct737139.1, si:dkeyp-7c9.1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • KREMEN1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3310314
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
NCBI Accession:
NM_001039571
Species:
Human
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of KREMEN1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5091566
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
NCBI Accession:
NM_032396
Species:
Mouse (Murine)
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Kremen1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5091568
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
NCBI Accession:
NM_053649
Species:
Rat (Rattus)
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Kremen1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5091570
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Kringle Containing Transmembrane Protein 1 (KREMEN1)
Gene ID:
83999 (Human, KREMEN1)
Synonyms:
KREMEN1, kremen1, Kremen1, kremen1.S
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5063474

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5044529
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Kringle Containing Transmembrane Protein 1
Gene ID:
83999 (Human, KREMEN1)
Synonyms:
KREMEN1, krm1, kremen, kremem1, KREMEN, KRM1, AV002070, Kremen, Krm1, si:ct737139.1, si:dkeyp-7c9.1
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5785008
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to KREMEN1

  • kringle containing transmembrane protein 1 (KREMEN1)
  • kringle containing transmembrane protein 1 (kremen1)
  • kringle containing transmembrane protein 1 (Kremen1)
  • kringle containing transmembrane protein 1 S homeolog (kremen1.S)
  • AV002070
  • kremem1
  • kremen
  • KREMEN
  • Kremen
  • KREMEN1
  • krm1
  • KRM1
  • Krm1
  • si:ct737139.1
  • si:dkeyp-7c9.1

Gene-IDs for different species

GENE IDSPECIES
416920 Gallus gallus
486340 Canis lupus familiaris
524357 Bos taurus
748246 Pan troglodytes
100064476 Equus caballus
100144698 Xenopus (Silurana) tropicalis
100407744 Callithrix jacchus
100438112 Pongo abelii
100470669 Ailuropoda melanoleuca
100543996 Meleagris gallopavo
100595234 Nomascus leucogenys
83999 Homo sapiens
84035 Mus musculus
398249 Xenopus laevis
114107 Rattus norvegicus
100141352 Danio rerio

Protein level used designations for KREMEN1

  • kringle containing transmembrane protein 1
  • kringle-containing transmembrane protein 1
  • kremen 1
  • kremen protein 1-like
  • dickkopf receptor
  • kremen protein 1
  • kringle domain-containing transmembrane protein 1
  • kringle-coding gene marking the eye and the nose
  • kringle-containing protein marking the eye and the nose
  • krm1
Other products related to KREMEN1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com