LALBA (Lactalbumin, alpha-, LALBA)

Short Description: This gene encodes alpha-lactalbumin, a principal protein of milk. Alpha-lactalbumin forms the regulatory subunit of the lactose synthase (LS) heterodimer and beta 1,4-galactosyltransferase (beta4Gal-T1) forms the catalytic component. Together, these proteins enable LS to produce lactose by transfering galactose moieties to glucose. As a monomer, alpha-lactalbumin strongly binds calcium and zinc ions and may possess bactericidal or antitumor activity. A folding variant of alpha-lactalbumin, called HAMLET, likely induces apoptosis in tumor and immature cells. [provided by RefSeq, Jul 2008].
More information related to gene LALBA.
Products related to LALBA Gene:
118 Products
Type
  • 111
  • 7
Species
  • 56
  • 32
  • 28
  • 2
Application
  • 63
  • 29
  • 27
  • 16
  • 1
Fusion tag
  • 45
  • 16
  • 11
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 41
  • 36
  • 12
  • 9
  • 9
Insert
  • 40
  • 34
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 44
  • 43
  • 18
  • 6
  • 2
Expression Type
  • 90
  • 50
  • 11
Selectable Marker
  • 29
  • 26
  • 11
  • 1
Promoter
  • 31
  • 31
  • 23
  • 13
  • 8
Format
  • 50
  • 27
  • 22
  • 19

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
16770 (Mouse (Murine), LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215767
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
16770 (Mouse (Murine), LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215769
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
3906 (Human, LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098257
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
281894 (Cow (Bovine), LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3839271
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
3906 (Human, LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999622
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
3906 (Human, LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999623
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Species:
Human
Synonyms:
LALBA, Lalba
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561590
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Lactalbumin, alpha-
Species:
Human
Synonyms:
LALBA, AW208827, a-LACTA, alfaLA
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3192584
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
16770 (Mouse (Murine), LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215768
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
16770 (Mouse (Murine), LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215771
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
3906 (Human, LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098258
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
281894 (Cow (Bovine), LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3839272
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
3906 (Human, LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999624
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
3906 (Human, LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999625
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
3906 (Human, LALBA)
Synonyms:
LALBA, Lalba
Insert length:
429 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5323685
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
3906 (Human, LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3427776
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Lactalbumin, alpha- (LALBA)
Gene ID:
3906 (Human, LALBA)
Synonyms:
LALBA, Lalba
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3398290
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Lactalbumin, alpha- (LALBA)
NCBI Accession:
NM_002289,NP_002280
Species:
Human
Synonyms:
LALBA, Lalba
Insert length:
429 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5404463
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Lactalbumin, alpha- (LALBA)
NCBI Accession:
NM_012594,NP_036726
Species:
Rat (Rattus)
Synonyms:
LALBA, Lalba
Insert length:
480 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5404464
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Lactalbumin, alpha- (LALBA)
NCBI Accession:
NM_002289,NP_002280
Species:
Human
Synonyms:
LALBA, Lalba
Insert length:
800 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3390516
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to LALBA

  • lactalbumin alpha (LALBA)
  • lactalbumin, alpha (Lalba)
  • lactalbumin alpha (Lalba)
  • a-LACTA
  • alfaLA
  • AW208827
  • LALBA

Gene-IDs for different species

GENE IDSPECIES
707442 Macaca mulatta
743291 Pan troglodytes
24528 Rattus norvegicus
16770 Mus musculus
100379577 Cavia porcellus
3906 Homo sapiens
281894 Bos taurus
100008717 Oryctolagus cuniculus
397647 Sus scrofa
101090027 Felis catus
403730 Canis lupus familiaris
100860779 Capra hircus
443386 Ovis aries

Protein level used designations for LALBA

  • Lactose synthase B protein
  • lactalbumin, alpha-
  • alpha-lactalbumin
  • lactose synthase B protein
  • lysozyme-like protein 7
  • alpha lactalbumin
  • alpha-lactalbumin A
  • alpha-lactalbumin B
  • lactalbumin, alpha
  • prealpha-lactalbumin
Other products related to LALBA such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com