Leptin Receptor (Leptin Receptor, LEPR)

Short Description: The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010].
More information related to gene Leptin Receptor.
Products related to Leptin Receptor Gene:
156 Products
Data Quality
  • 2
Type
  • 149
  • 7
Species
  • 63
  • 63
  • 28
  • 2
Application
  • 96
  • 28
  • 27
  • 12
  • 1
Fusion tag
  • 37
  • 31
  • 25
  • 17
  • 8
Vector Backbone
  • 16
  • 16
  • 13
  • 6
  • 6
Vector
  • 58
  • 51
  • 20
  • 9
  • 9
Insert
  • 66
  • 50
  • 21
  • 6
  • 4
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 67
  • 40
  • 36
  • 6
  • 2
Expression Type
  • 132
  • 59
  • 11
Selectable Marker
  • 41
  • 24
  • 11
Promoter
  • 70
  • 27
  • 21
  • 20
  • 6
Format
  • 78
  • 43
  • 26
  • 9

Type:
cDNA
Application:
Cloning
Gene:
Leptin Receptor (LEPR)
Gene ID:
16847 (Mouse (Murine), LEPR)
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4099119
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Leptin Receptor (LEPR)
Gene ID:
380528 (Xenopus laevis, LEPR)
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041290
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Leptin Receptor (LEPR)
NCBI Accession:
NM_002303
Species:
Human
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561640
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Leptin Receptor
Species:
Human
Synonyms:
CD295, LEP-R, LEPRD, OB-R, OBR, obr, cd295, ob-rb, Fa, LEPROT, Leprb, Modb1, OB-RGRP, Obr, db, diabetes, obese-like, obl, ObRb, Ob-R, Ob-RM, lepr
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188697
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Leptin Receptor (LEPR)
Gene ID:
16847 (Mouse (Murine), LEPR)
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4099120
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Leptin Receptor (LEPR)
Gene ID:
380528 (Xenopus laevis, LEPR)
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041289
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Leptin Receptor (LEPR)
Gene ID:
3953 (Human, LEPR)
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3417059
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Leptin Receptor (LEPR)
NCBI Accession:
NM_002303
Species:
Human
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3916373
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Leptin Receptor (LEPR)
NCBI Accession:
NM_002303
Species:
Human
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3916375
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Leptin Receptor (LEPR)
NCBI Accession:
NM_002303
Species:
Human
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3916376
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Leptin Receptor (LEPR)
NCBI Accession:
NM_002303
Species:
Human
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3916372
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Leptin Receptor (LEPR)
NCBI Accession:
NM_002303
Species:
Human
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3916369
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Leptin Receptor (LEPR)
NCBI Accession:
NM_002303
Species:
Human
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3916368
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Leptin Receptor (LEPR)
NCBI Accession:
NM_002303
Species:
Human
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3916366
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Leptin Receptor (LEPR)
NCBI Accession:
NM_002303
Species:
Human
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3916370
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
RNA Interference
Gene:
Leptin Receptor
Species:
Mouse (Murine)
Synonyms:
CD295, LEP-R, LEPRD, OB-R, OBR, obr, cd295, ob-rb, Fa, LEPROT, Leprb, Modb1, OB-RGRP, Obr, db, diabetes, obese-like, obl, ObRb, Ob-R, Ob-RM, lepr
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Lepr (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3347260
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Leptin Receptor
Species:
Rat (Rattus)
Synonyms:
CD295, LEP-R, LEPRD, OB-R, OBR, obr, cd295, ob-rb, Fa, LEPROT, Leprb, Modb1, OB-RGRP, Obr, db, diabetes, obese-like, obl, ObRb, Ob-R, Ob-RM, lepr
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Lepr (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3361889
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Leptin Receptor
Species:
Human
Synonyms:
CD295, LEP-R, LEPRD, OB-R, OBR, obr, cd295, ob-rb, Fa, LEPROT, Leprb, Modb1, OB-RGRP, Obr, db, diabetes, obese-like, obl, ObRb, Ob-R, Ob-RM, lepr
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • LEPR (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3342453
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Leptin Receptor (LEPR)
NCBI Accession:
NM_146146
Species:
Mouse (Murine)
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Lepr
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5107305
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Leptin Receptor (LEPR)
NCBI Accession:
NM_012596
Species:
Rat (Rattus)
Synonyms:
LEPR, lepr, Lepr, lepr.S
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Lepr
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5107307
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to Leptin Receptor

  • leptin receptor (LEPR)
  • leptin receptor (lepr)
  • leptin receptor (Lepr)
  • leptin receptor S homeolog (lepr.S)
  • CD295
  • cd295
  • db
  • diabetes
  • Fa
  • LEP-R
  • lepr
  • Leprb
  • LEPRD
  • LEPROT
  • Modb1
  • OB-R
  • Ob-R
  • ob-rb
  • OB-RGRP
  • Ob-RM
  • obese-like
  • obl
  • obr
  • OBR
  • Obr
  • ObRb

Gene-IDs for different species

GENE IDSPECIES
3953 Homo sapiens
724071 Xenopus (Silurana) tropicalis
24536 Rattus norvegicus
16847 Mus musculus
374223 Gallus gallus
450207 Canis lupus familiaris
100725434 Cavia porcellus
396836 Sus scrofa
443264 Ovis aries
100351924 Oryctolagus cuniculus
497205 Bos taurus
574126 Macaca mulatta
734227 Xenopus laevis

Protein level used designations for Leptin Receptor

  • OB receptor
  • huB219
  • LEP-R
  • Leptin receptor (fatty)
  • OB-R
  • B219
  • leptin receptor gene-related protein
  • cytokine receptor
  • leptin receptor long insert isoform
  • leptin receptor
Other products related to Leptin Receptor such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com