LGR5 (Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5, LGR5)

Short Description: Orphan receptor. Stem cell marker of the intestinal epithelium and the hair follicule. Target gene of Wnt signaling.
More information related to gene LGR5.
Products related to LGR5 Gene:
103 Products
Data Quality
  • 1
Type
  • 98
  • 5
Species
  • 48
  • 28
  • 27
Application
  • 52
  • 26
  • 21
  • 16
Fusion tag
  • 36
  • 16
  • 12
  • 9
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 36
  • 30
  • 12
  • 9
  • 8
Insert
  • 37
  • 24
  • 21
  • 8
  • 6
Oligo-Type
  • 5
Resistance Gene
  • 46
  • 31
  • 18
  • 3
  • 2
Expression Type
  • 87
  • 52
Selectable Marker
  • 29
  • 26
  • 8
  • 1
Promoter
  • 35
  • 31
  • 13
  • 8
  • 8
Format
  • 42
  • 24
  • 22
  • 15

Type:
cDNA
Application:
Cloning
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Gene ID:
8549 (Human, LGR5)
Synonyms:
lgr5.L, Lgr5, LGR5
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986917
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Gene ID:
8549 (Human, LGR5)
Synonyms:
lgr5.L, Lgr5, LGR5
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986919
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Gene ID:
8549 (Human, LGR5)
Synonyms:
lgr5.L, Lgr5, LGR5
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986920
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Gene ID:
8549 (Human, LGR5)
Synonyms:
lgr5.L, Lgr5, LGR5
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986921
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Gene ID:
8549 (Human, LGR5)
Synonyms:
lgr5.L, Lgr5, LGR5
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986918
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Gene ID:
8549 (Human, LGR5)
Synonyms:
lgr5.L, Lgr5, LGR5
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986922
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Gene ID:
8549 (Human, LGR5)
Synonyms:
lgr5.L, Lgr5, LGR5
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986923
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Gene ID:
8549 (Human, LGR5)
Synonyms:
lgr5.L, Lgr5, LGR5
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986924
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Gene ID:
8549 (Human, LGR5)
Synonyms:
lgr5.L, Lgr5, LGR5
Insert length:
2724 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5325637
$208.97
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Gene ID:
14160 (Mouse (Murine), LGR5)
Synonyms:
lgr5.L, Lgr5, LGR5
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3433635
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Gene ID:
8549 (Human, LGR5)
Synonyms:
lgr5.L, Lgr5, LGR5
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3413730
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
NCBI Accession:
NM_003667
Species:
Human
Synonyms:
lgr5.L, Lgr5, LGR5
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of LGR5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5137694
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
NCBI Accession:
NM_010195
Species:
Mouse (Murine)
Synonyms:
lgr5.L, Lgr5, LGR5
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Lgr5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5137696
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
NCBI Accession:
NM_001106784
Species:
Rat (Rattus)
Synonyms:
lgr5.L, Lgr5, LGR5
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Lgr5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5137698
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
NCBI Accession:
NM_003667,NP_003658
Species:
Human
Synonyms:
lgr5.L, Lgr5, LGR5
Insert length:
2724 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5433856
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5
Species:
Mouse (Murine)
Synonyms:
lgr5-a, lgr5a, FEX, Gpr49, GPR49, GPR67, GRP49, HG38
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Lgr5 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3347981
$430.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5
Species:
Rat (Rattus)
Synonyms:
lgr5-a, lgr5a, FEX, Gpr49, GPR49, GPR67, GRP49, HG38
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Lgr5 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3352641
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Species:
Human
Synonyms:
lgr5.L, Lgr5, LGR5
Insert length:
2724 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4420054
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Species:
Human
Synonyms:
lgr5.L, Lgr5, LGR5
Insert length:
2724 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4628611
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5)
Species:
Human
Synonyms:
lgr5.L, Lgr5, LGR5
Insert length:
2724 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4485140
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to LGR5

  • leucine-rich repeat containing G protein-coupled receptor 5 L homeolog (lgr5.L)
  • leucine rich repeat containing G protein coupled receptor 5 (Lgr5)
  • leucine rich repeat containing G protein-coupled receptor 5 (LGR5)
  • FEX
  • Gpr49
  • GPR49
  • GPR67
  • GRP49
  • HG38
  • lgr5-a
  • lgr5a

Gene-IDs for different species

GENE IDSPECIES
100526795 Xenopus laevis
14160 Mus musculus
299802 Rattus norvegicus
8549 Homo sapiens
427867 Gallus gallus

Protein level used designations for LGR5

  • leucine-rich repeat-containing G protein-coupled receptor 5
  • leucine-rich repeat-containing G-protein coupled receptor 5A
  • leucine-rich repeat-containing G-protein coupled receptor 5a
  • G protein-coupled receptor 49
  • G-protein coupled receptor 49
  • follicle expressed hormone
  • leucine-rich repeat-containing G-protein coupled receptor 5
  • orphan G-protein coupled receptor FEX
  • G-protein coupled receptor 67
  • G-protein coupled receptor HG38
  • orphan G protein-coupled receptor HG38
Other products related to LGR5 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com