LILRB4 (Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4, LILRB4)

Short Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. The receptor can also function in antigen capture and presentation. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.
More information related to gene LILRB4.
Products related to LILRB4 Gene:
126 Products
  • 122
  • 4
  • 68
  • 32
  • 26
  • 79
  • 24
  • 23
  • 16
Fusion tag
  • 42
  • 17
  • 16
  • 11
  • 8
Vector Backbone
  • 15
  • 7
  • 6
  • 6
  • 6
  • 54
  • 37
  • 12
  • 9
  • 5
  • 47
  • 39
  • 20
  • 8
  • 6
  • 4
Resistance Gene
  • 56
  • 42
  • 19
  • 5
  • 2
Expression Type
  • 104
  • 54
  • 11
Selectable Marker
  • 34
  • 26
  • 11
  • 1
  • 42
  • 30
  • 26
  • 13
  • 8
  • 63
  • 27
  • 22
  • 14

Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
11006 (Human, LILRB4)
LILRB4, Lilrb4a
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4212096
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
14728 (Mouse (Murine), LILRB4)
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4214981
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
14728 (Mouse (Murine), LILRB4)
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4214980
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
LILRB4, Lilrb4a
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3561681
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
LILRB4, Lilrb4a
Insert length:
1347 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5751491
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
Mouse (Murine)
LILRB4, Lilrb4a
Insert length:
1008 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5751492
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
11006 (Human, LILRB4)
LILRB4, Lilrb4a
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4212095
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
14728 (Mouse (Murine), LILRB4)
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4214979
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
14728 (Mouse (Murine), LILRB4)
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4214978
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
11006 (Human, LILRB4)
LILRB4, Lilrb4a
Insert length:
1347 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5317250
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
ISO 9001:2008

Protein Expression
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
Gene ID:
11006 (Human, LILRB4)
LILRB4, Lilrb4a
Insert length:
765 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4938041
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Protein Expression
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
Mouse (Murine)
LILRB4, Lilrb4a
Insert length:
747 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3328232
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3949982
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
MYC tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3949986
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3949988
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3949992
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
His tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3949990
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
His tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3949985
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
MYC tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3949991
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
HA tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3949989
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to LILRB4

  • leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 (LILRB4)
  • leukocyte immunoglobulin like receptor B4 (LILRB4)
  • leukocyte immunoglobulin-like receptor, subfamily B, member 4A (Lilrb4a)
  • CD85K
  • gp49
  • Gp49b
  • HM18
  • ILT-3
  • ILT3
  • LIR-5
  • LIR5

Gene-IDs for different species

100587262 Nomascus leucogenys
11006 Homo sapiens
14728 Mus musculus

Protein level used designations for LILRB4

  • leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4
  • CD85 antigen-like family member K
  • immunoglobulin-like transcript 3
  • leukocyte immunoglobulin-like receptor 5
  • leukocyte immunoglobulin-like receptor subfamily B member 4
  • monocyte inhibitory receptor HM18
  • glycoprotein 49 B
  • mast cell surface glycoprotein Gp49B
Other products related to LILRB4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website