LILRB4 (Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4, LILRB4)

Short Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. The receptor can also function in antigen capture and presentation. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.
More information related to gene LILRB4.
Products related to LILRB4 Gene:
126 Products
Type
  • 122
  • 4
Species
  • 68
  • 32
  • 26
Application
  • 79
  • 24
  • 23
  • 16
Fusion tag
  • 42
  • 17
  • 16
  • 11
  • 8
Vector Backbone
  • 15
  • 7
  • 6
  • 6
  • 6
Vector
  • 54
  • 37
  • 12
  • 9
  • 5
Insert
  • 47
  • 39
  • 20
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 56
  • 42
  • 19
  • 5
  • 2
Expression Type
  • 104
  • 54
  • 11
Selectable Marker
  • 34
  • 26
  • 11
  • 1
Promoter
  • 42
  • 30
  • 26
  • 13
  • 8
Format
  • 63
  • 27
  • 22
  • 14
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Species:
Human
Synonyms:
LILRB4, Lilrb4a
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751491
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
NM_013532
Species:
Mouse (Murine)
Synonyms:
LILRB4, Lilrb4a
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751492
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
11006 (Human, LILRB4)
Synonyms:
LILRB4, Lilrb4a
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4212096
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
14728 (Mouse (Murine), LILRB4)
Synonyms:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4214981
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
14728 (Mouse (Murine), LILRB4)
Synonyms:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4214980
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
NM_001278426
Species:
Human
Synonyms:
LILRB4, Lilrb4a
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561681
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
14728 (Mouse (Murine), LILRB4)
Synonyms:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4214979
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
14728 (Mouse (Murine), LILRB4)
Synonyms:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4214978
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
11006 (Human, LILRB4)
Synonyms:
LILRB4, Lilrb4a
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4212095
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
Gene ID:
11006 (Human, LILRB4)
Synonyms:
LILRB4, Lilrb4a
Insert length:
1347 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5317250
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
NM_001278430
Gene ID:
11006 (Human, LILRB4)
Synonyms:
LILRB4, Lilrb4a
Insert length:
765 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4938041
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
NM_001291894,NP_001278823
Species:
Mouse (Murine)
Synonyms:
LILRB4, Lilrb4a
Insert length:
747 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3328232
$240.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
NM_001278426
Species:
Human
Synonyms:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3949985
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
NM_001278426
Species:
Human
Synonyms:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3949991
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
NM_001278426
Species:
Human
Synonyms:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3949992
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
NM_001278426
Species:
Human
Synonyms:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3949989
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
NM_001278426
Species:
Human
Synonyms:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3949990
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
NM_001278426
Species:
Human
Synonyms:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3949988
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
NM_001278426
Species:
Human
Synonyms:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3949982
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM and ITIM Domains), Member 4 (LILRB4)
NCBI Accession:
NM_001278426
Species:
Human
Synonyms:
LILRB4, Lilrb4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3949984
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to LILRB4

  • leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 (LILRB4)
  • leukocyte immunoglobulin like receptor B4 (LILRB4)
  • leukocyte immunoglobulin-like receptor, subfamily B, member 4A (Lilrb4a)
  • CD85K
  • gp49
  • Gp49b
  • HM18
  • ILT-3
  • ILT3
  • LIR-5
  • LIR5

Gene-IDs for different species

GENE IDSPECIES
100587262 Nomascus leucogenys
11006 Homo sapiens
14728 Mus musculus

Protein level used designations for LILRB4

  • leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4
  • CD85 antigen-like family member K
  • immunoglobulin-like transcript 3
  • leukocyte immunoglobulin-like receptor 5
  • leukocyte immunoglobulin-like receptor subfamily B member 4
  • monocyte inhibitory receptor HM18
  • glycoprotein 49 B
  • mast cell surface glycoprotein Gp49B
Other products related to LILRB4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com