Macrophage Mannose Receptor 1 (Mannose Receptor, C Type 1, MRC1)

Short Description: The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Apr 2011].
More information related to gene Macrophage Mannose Receptor 1.
Products related to Macrophage Mannose Receptor 1 Gene:
102 Products
Type
  • 97
  • 5
Species
  • 36
  • 35
  • 29
  • 2
Application
  • 55
  • 28
  • 21
  • 15
  • 1
Fusion tag
  • 37
  • 16
  • 10
  • 8
  • 8
Vector Backbone
  • 8
  • 8
  • 7
  • 6
  • 4
Vector
  • 36
  • 36
  • 12
  • 8
  • 4
Insert
  • 27
  • 25
  • 24
  • 11
  • 8
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 41
  • 38
  • 16
  • 2
  • 2
Expression Type
  • 83
  • 53
  • 11
Selectable Marker
  • 32
  • 25
  • 11
  • 2
Promoter
  • 39
  • 24
  • 20
  • 10
  • 8
Format
  • 54
  • 22
  • 18
  • 8

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mannose Receptor, C Type 1 (MRC1)
Gene ID:
446742 (Xenopus laevis, MRC1)
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851498
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mannose Receptor, C Type 1 (MRC1)
Gene ID:
17533 (Mouse (Murine), MRC1)
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996744
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mannose Receptor, C Type 1 (MRC1)
NCBI Accession:
NM_001106123
Species:
Rat (Rattus)
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104328
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Mannose Receptor, C Type 1
Species:
Rat (Rattus)
Synonyms:
CD206, CLEC13D, CLEC13DL, MMR, MRC1L1, bA541I19.1, AW259686, MR, mrc1, MGC86525, MRC1, MRC1L-A
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196503
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mannose Receptor, C Type 1 (MRC1)
Gene ID:
446742 (Xenopus laevis, MRC1)
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851499
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mannose Receptor, C Type 1 (MRC1)
Gene ID:
17533 (Mouse (Murine), MRC1)
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996743
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mannose Receptor, C Type 1 (MRC1)
NCBI Accession:
NM_002438
Species:
Human
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MRC1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5085130
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mannose Receptor, C Type 1 (MRC1)
NCBI Accession:
NM_001009567
Species:
Human
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MRC1L1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5085132
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mannose Receptor, C Type 1 (MRC1)
NCBI Accession:
NM_008625
Species:
Mouse (Murine)
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mrc1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5085134
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mannose Receptor, C Type 1 (MRC1)
NCBI Accession:
NM_001106123
Species:
Rat (Rattus)
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mrc1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5085136
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Application:
RNA Interference
Gene:
Mannose Receptor, C Type 1
Species:
Mouse (Murine)
Synonyms:
CD206, CLEC13D, CLEC13DL, MMR, MRC1L1, bA541I19.1, AW259686, MR, mrc1, MGC86525, MRC1, MRC1L-A
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Mrc1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3349723
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Mannose Receptor, C Type 1
Species:
Rat (Rattus)
Synonyms:
CD206, CLEC13D, CLEC13DL, MMR, MRC1L1, bA541I19.1, AW259686, MR, mrc1, MGC86525, MRC1, MRC1L-A
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Mrc1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3353122
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Mannose Receptor, C Type 1
Species:
Human
Synonyms:
CD206, CLEC13D, CLEC13DL, MMR, MRC1L1, bA541I19.1, AW259686, MR, mrc1, MGC86525, MRC1, MRC1L-A
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • MRC1L1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3273313
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Mannose Receptor, C Type 1
Species:
Human
Synonyms:
CD206, CLEC13D, CLEC13DL, MMR, MRC1L1, bA541I19.1, AW259686, MR, mrc1, MGC86525, MRC1, MRC1L-A
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • MRC1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3342741
$430.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mannose Receptor, C Type 1 (MRC1)
NCBI Accession:
NM_001106123
Species:
Rat (Rattus)
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3922916
$455.88
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mannose Receptor, C Type 1 (MRC1)
NCBI Accession:
NM_001106123
Species:
Rat (Rattus)
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3922918
$455.88
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mannose Receptor, C Type 1 (MRC1)
NCBI Accession:
NM_001106123
Species:
Rat (Rattus)
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3922919
$455.88
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mannose Receptor, C Type 1 (MRC1)
NCBI Accession:
NM_001106123
Species:
Rat (Rattus)
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3922920
$455.88
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mannose Receptor, C Type 1 (MRC1)
NCBI Accession:
NM_001106123
Species:
Rat (Rattus)
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3922922
$455.88
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mannose Receptor, C Type 1 (MRC1)
NCBI Accession:
NM_001106123
Species:
Rat (Rattus)
Synonyms:
MRC1, Mrc1, mrc1.L, mrc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3922923
$455.88
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to Macrophage Mannose Receptor 1

  • mannose receptor C-type 1 (MRC1)
  • mannose receptor, C type 1 (Mrc1)
  • mannose receptor C-type 1 L homeolog (mrc1.L)
  • mediator of replication checkpoint 1 (mrc1)
  • mannose receptor C-type 1 (Mrc1)
  • AW259686
  • bA541I19.1
  • CD206
  • CLEC13D
  • CLEC13DL
  • MGC86525
  • MMR
  • MR
  • mrc1
  • MRC1
  • MRC1L-A
  • MRC1L1

Gene-IDs for different species

GENE IDSPECIES
4360 Homo sapiens
17533 Mus musculus
291327 Rattus norvegicus
446742 Xenopus laevis
450333 Pan troglodytes
487114 Canis lupus familiaris
701010 Macaca mulatta
100505388 Ovis aries
445003 Sus scrofa
100345866 Oryctolagus cuniculus
2543240 Schizosaccharomyces pombe 972h-
420516 Gallus gallus
100720301 Cavia porcellus

Protein level used designations for Macrophage Mannose Receptor 1

  • C-type lectin domain family 13 member D
  • macrophage mannose receptor 1
  • macrophage mannose receptor 1-like protein 1
  • mannose receptor, C type 1-like 1
  • MMR
  • mannose receptor, C type 1
  • mannose C-type lectin receptor
  • macrophage mannose receptor C type-1
  • mannose receptor C1
  • DNA replication checkpoint mediator mrc1
  • macrophage mannose receptor 1-like
  • mannose receptor C-type 1
Other products related to Macrophage Mannose Receptor 1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com