Macrophage Scavenger Receptor 1 (Macrophage Scavenger Receptor 1, MSR1)

Short Description: This gene encodes the class A macrophage scavenger receptors, which include three different types (1, 2, 3) generated by alternative splicing of this gene. These receptors or isoforms are macrophage-specific trimeric integral membrane glycoproteins and have been implicated in many macrophage-associated physiological and pathological processes including atherosclerosis, Alzheimer's disease, and host defense. The isoforms type 1 and type 2 are functional receptors and are able to mediate the endocytosis of modified low density lipoproteins (LDLs). The isoform type 3 does not internalize modified LDL (acetyl-LDL) despite having the domain shown to mediate this function in the types 1 and 2 isoforms. It has an altered intracellular processing and is trapped within the endoplasmic reticulum, making it unable to perform endocytosis. The isoform type 3 can inhibit the function of isoforms type 1 and type 2 when co-expressed, indicating a dominant negative effect and suggesting a mechanism for regulation of scavenger receptor activity in macrophages. [provided by RefSeq, Jul 2008].
More information related to gene Macrophage Scavenger Receptor 1.
Products related to Macrophage Scavenger Receptor 1 Gene:
Type
  • 134
  • 5
Species
  • 66
  • 41
  • 30
  • 2
Application
  • 93
  • 29
  • 16
  • 16
  • 3
Fusion tag
  • 40
  • 17
  • 16
  • 16
  • 8
Vector Backbone
  • 10
  • 10
  • 6
  • 6
  • 6
Vector
  • 60
  • 43
  • 16
  • 6
  • 4
Insert
  • 60
  • 44
  • 14
  • 8
  • 6
Oligo-Type
  • 3
  • 2
Resistance Gene
  • 59
  • 44
  • 24
  • 7
  • 2
Expression Type
  • 107
  • 51
  • 22
Selectable Marker
  • 29
  • 22
  • 22
  • 1
Promoter
  • 46
  • 35
  • 24
  • 19
  • 8
Format
  • 64
  • 36
  • 26
  • 13
139 Products

Type:
ORF
Application:
Cloning
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
Species:
Human
Synonyms:
MSR1, Msr1, SCARA5
Insert length:
1356 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5721780
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
Gene ID:
281311 (Cow (Bovine), MSR1)
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3838813
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
Gene ID:
4481 (Human, MSR1)
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875131
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
Gene ID:
20288 (Mouse (Murine), MSR1)
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217204
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
NCBI Accession:
NM_001191939
Species:
Rat (Rattus)
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562557
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
NCBI Accession:
NM_138715
Species:
Human
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887380
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Macrophage Scavenger Receptor 1
Species:
Mouse (Murine)
Synonyms:
CD204, SCARA1, SR-A, SRA, phSR1, phSR2, MRS-A, MSR, MSR-A, SR-AI, SR-AII, Scara1, Scvr, MSR1, RGD1564316
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193715
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Macrophage Scavenger Receptor 1
Species:
Rat (Rattus)
Synonyms:
CD204, SCARA1, SR-A, SRA, phSR1, phSR2, MRS-A, MSR, MSR-A, SR-AI, SR-AII, Scara1, Scvr, MSR1, RGD1564316
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196497
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Macrophage Scavenger Receptor 1
Species:
Human
Synonyms:
CD204, SCARA1, SR-A, SRA, phSR1, phSR2, MRS-A, MSR, MSR-A, SR-AI, SR-AII, Scara1, Scvr, MSR1, RGD1564316
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188792
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
Gene ID:
281311 (Cow (Bovine), MSR1)
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3838814
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
Gene ID:
4481 (Human, MSR1)
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804617
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
Gene ID:
20288 (Mouse (Murine), MSR1)
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217205
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
Gene ID:
4481 (Human, MSR1)
Synonyms:
MSR1, Msr1, SCARA5
Insert length:
1356 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5322257
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
NCBI Accession:
NM_138715
Species:
Human
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3923637
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
NCBI Accession:
NM_138715
Species:
Human
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3923639
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
NCBI Accession:
NM_138715
Species:
Human
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3923638
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
NCBI Accession:
NM_138715
Species:
Human
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3923640
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
NCBI Accession:
NM_138715
Species:
Human
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3923641
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
NCBI Accession:
NM_001191939
Species:
Rat (Rattus)
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3923642
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Macrophage Scavenger Receptor 1 (MSR1)
NCBI Accession:
NM_001191939
Species:
Rat (Rattus)
Synonyms:
MSR1, Msr1, SCARA5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3923644
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to Macrophage Scavenger Receptor 1

  • macrophage scavenger receptor 1 (MSR1)
  • macrophage scavenger receptor 1 (Msr1)
  • scavenger receptor class A member 5 (SCARA5)
  • CD204
  • MRS-A
  • MSR
  • MSR-A
  • MSR1
  • phSR1
  • phSR2
  • RGD1564316
  • SCARA1
  • Scara1
  • Scvr
  • SR-A
  • SR-AI
  • SR-AII
  • SRA

Gene-IDs for different species

GENE IDSPECIES
4481 Homo sapiens
20288 Mus musculus
281311 Bos taurus
464003 Pan troglodytes
482891 Canis lupus familiaris
498638 Rattus norvegicus
709365 Macaca mulatta
100009067 Oryctolagus cuniculus
100386222 Callithrix jacchus
100602129 Nomascus leucogenys
100511665 Sus scrofa
100349984 Oryctolagus cuniculus
100731555 Cavia porcellus
100053116 Equus caballus

Protein level used designations for Macrophage Scavenger Receptor 1

  • macrophage acetylated LDL receptor I and II
  • macrophage scavenger receptor type III
  • macrophage scavenger receptor types I and II
  • scavenger receptor class A member 1
  • scavenger receptor class A, member 1
  • SR-A
  • scavenger receptor type A
  • macrophage scavenger receptor 1
  • macrophage scavenger receptor type I
  • macrophage scavenger receptor types I and II-like
Other products related to Macrophage Scavenger Receptor 1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com