MAL2 (Mal, T Cell Differentiation Protein 2, MAL2)

Short Description: This gene encodes a multispan transmembrane protein belonging to the MAL proteolipid family. The protein is a component of lipid rafts and, in polarized cells, it primarily localizes to endosomal structures beneath the apical membrane. It is required for transcytosis, an intracellular transport pathway used to deliver membrane-bound proteins and exogenous cargos from the basolateral to the apical surface. [provided by RefSeq, Jul 2008].
More information related to gene MAL2.
Products related to MAL2 Gene:
111 Products
Type
  • 107
  • 4
Species
  • 42
  • 33
  • 28
  • 4
  • 2
Application
  • 64
  • 31
  • 24
  • 16
Fusion tag
  • 44
  • 12
  • 11
  • 8
  • 7
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 4
Vector
  • 46
  • 31
  • 12
  • 9
  • 6
Insert
  • 42
  • 29
  • 20
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 48
  • 41
  • 14
  • 4
  • 2
Expression Type
  • 88
  • 47
  • 13
  • 2
Selectable Marker
  • 26
  • 23
  • 13
  • 2
Promoter
  • 30
  • 30
  • 24
  • 13
  • 8
Format
  • 42
  • 27
  • 22
  • 20

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Gene ID:
114569 (Human, MAL2)
Synonyms:
Mal2, MAL2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3831260
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Gene ID:
362911 (Rat (Rattus), MAL2)
Synonyms:
Mal2, MAL2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3881008
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Gene ID:
444282 (Xenopus laevis, MAL2)
Synonyms:
Mal2, MAL2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850182
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Gene ID:
444282 (Xenopus laevis, MAL2)
Synonyms:
Mal2, MAL2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850185
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Gene ID:
511940 (Cow (Bovine), MAL2)
Synonyms:
Mal2, MAL2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062409
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Gene ID:
105853 (Mouse (Murine), MAL2)
Synonyms:
Mal2, MAL2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3991799
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
NCBI Accession:
NM_178920
Species:
Mouse (Murine)
Synonyms:
Mal2, MAL2
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562153
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Species:
Human
Synonyms:
Mal2, MAL2
Insert length:
531 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5736651
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Gene ID:
114569 (Human, MAL2)
Synonyms:
Mal2, MAL2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3831259
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Gene ID:
362911 (Rat (Rattus), MAL2)
Synonyms:
Mal2, MAL2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3881007
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Gene ID:
444282 (Xenopus laevis, MAL2)
Synonyms:
Mal2, MAL2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850183
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Gene ID:
444282 (Xenopus laevis, MAL2)
Synonyms:
Mal2, MAL2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850184
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Gene ID:
511940 (Cow (Bovine), MAL2)
Synonyms:
Mal2, MAL2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062410
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Gene ID:
105853 (Mouse (Murine), MAL2)
Synonyms:
Mal2, MAL2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3991798
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Gene ID:
114569 (Human, MAL2)
Synonyms:
Mal2, MAL2
Insert length:
531 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5315450
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
NCBI Accession:
NM_052886,NP_443118
Species:
Human
Synonyms:
Mal2, MAL2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3384995
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Species:
Human
Synonyms:
Mal2, MAL2
Insert length:
531 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4477821
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Species:
Human
Synonyms:
Mal2, MAL2
Insert length:
531 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4621292
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Species:
Human
Synonyms:
Mal2, MAL2
Insert length:
531 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4769489
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Mal, T Cell Differentiation Protein 2 (MAL2)
Species:
Human
Synonyms:
Mal2, MAL2
Insert length:
531 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4438916
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to MAL2

  • mal, T cell differentiation protein 2 (Mal2)
  • mal, T-cell differentiation protein 2 (gene/pseudogene) (MAL2)
  • mal, T-cell differentiation protein 2 (Mal2)
  • mal, T-cell differentiation protein 2 (MAL2)
  • AI461653

Gene-IDs for different species

GENE IDSPECIES
105853 Mus musculus
114569 Homo sapiens
362911 Rattus norvegicus
511940 Bos taurus
100174457 Pongo abelii

Protein level used designations for MAL2

  • mal, T-cell differentiation protein 2
  • protein MAL2
  • MAL proteolipid protein 2
  • MAL2 proteolipid protein
  • MAL2A
Other products related to MAL2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com