MAPT (Microtubule-Associated Protein tau, MAPT)

Short Description: This gene encodes the microtubule-associated protein tau (MAPT) whose transcript undergoes complex, regulated alternative splicing, giving rise to several mRNA species. MAPT transcripts are differentially expressed in the nervous system, depending on stage of neuronal maturation and neuron type. MAPT gene mutations have been associated with several neurodegenerative disorders such as Alzheimer's disease, Pick's disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy. [provided by RefSeq, Jul 2008].
More information related to gene MAPT.
Products related to MAPT Gene:
184 Products
Data Quality
  • 2
  • 180
  • 4
  • 95
  • 56
  • 27
  • 2
  • 2
  • 135
  • 33
  • 23
  • 14
  • 1
Fusion tag
  • 53
  • 31
  • 26
  • 16
  • 12
Vector Backbone
  • 15
  • 15
  • 15
  • 8
  • 8
  • 95
  • 52
  • 16
  • 9
  • 5
  • 88
  • 58
  • 20
  • 8
  • 6
  • 3
  • 1
Resistance Gene
  • 76
  • 62
  • 36
  • 6
Expression Type
  • 150
  • 66
  • 26
Selectable Marker
  • 47
  • 26
  • 24
  • 1
  • 73
  • 53
  • 28
  • 23
  • 6
  • 104
  • 36
  • 29
  • 15

Microtubule-Associated Protein tau (MAPT)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Insert length:
1152 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5741590
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression, Cloning
Microtubule-Associated Protein tau (MAPT)
Gene ID:
17762 (Mouse (Murine), MAPT)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4216138
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Microtubule-Associated Protein tau (MAPT)
Gene ID:
29477 (Rat (Rattus), MAPT)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4046247
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Microtubule-Associated Protein tau (MAPT)
Gene ID:
281296 (Cow (Bovine), MAPT)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3838801
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Microtubule-Associated Protein tau (MAPT)
Gene ID:
779920 (Xenopus tropicalis, MAPT)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3870132
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Microtubule-Associated Protein tau (MAPT)
Gene ID:
398307 (Xenopus laevis, MAPT)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3882522
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Microtubule-Associated Protein tau (MAPT)
NCBI Accession:
Mouse (Murine)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3562194
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Microtubule-Associated Protein tau (MAPT)
NCBI Accession:
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47
  • RV-M
Catalog No. ABIN3887313
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
Microtubule-Associated Protein tau
DDPAC, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, TAU, AI413597, AW045860, Mtapt, Tau, RNPTAU, pTau, tau, xtp, MAPT, PHF-tau, slc6a6, taut, wu:fc26e12
-20 °C
Catalog No. ABIN3188481
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Protein Expression, Cloning
Microtubule-Associated Protein tau (MAPT)
Gene ID:
17762 (Mouse (Murine), MAPT)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4216139
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Microtubule-Associated Protein tau (MAPT)
Gene ID:
29477 (Rat (Rattus), MAPT)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4046248
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Microtubule-Associated Protein tau (MAPT)
Gene ID:
281296 (Cow (Bovine), MAPT)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3838802
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Microtubule-Associated Protein tau (MAPT)
Gene ID:
779920 (Xenopus tropicalis, MAPT)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3870133
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Microtubule-Associated Protein tau (MAPT)
Gene ID:
398307 (Xenopus laevis, MAPT)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3882523
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Microtubule-Associated Protein tau (MAPT)
Gene ID:
4137 (Human, MAPT)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Insert length:
1152 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5325249
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Microtubule-Associated Protein tau (MAPT)
Gene ID:
4137 (Human, MAPT)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3414812
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Microtubule-Associated Protein tau (MAPT)
NCBI Accession:
Mouse (Murine)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Insert length:
1026 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3329805
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
Microtubule-Associated Protein tau (MAPT)
NCBI Accession:
Mouse (Murine)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Insert length:
1053 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3329806
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
Microtubule-Associated Protein tau (MAPT)
NCBI Accession:
Mouse (Murine)
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Insert length:
1095 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3329807
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
Microtubule-Associated Protein tau (MAPT)
NCBI Accession:
MAPT, Mapt, mapt.S, LOC5580230, CpipJ_CPIJ013260, tau, slc6a6b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3388002
10 μg
Plus shipping costs $45.00
Will be delivered in 71 Business Days
  • <
  • 1

Synonyms and alternative names related to MAPT

  • microtubule associated protein tau (MAPT)
  • microtubule-associated protein tau (Mapt)
  • microtubule associated protein tau S homeolog (mapt.S)
  • microtubule-associated protein tau (LOC5580230)
  • microtubule-associated protein tau (CpipJ_CPIJ013260)
  • Microtubule-associated protein tau (tau)
  • microtubule associated protein tau (Mapt)
  • solute carrier family 6 (neurotransmitter transporter), member 6b (slc6a6b)
  • AI413597
  • AW045860
  • FTDP-17
  • MAPT
  • MSTD
  • Mtapt
  • MTBT1
  • MTBT2
  • PHF-tau
  • PPND
  • pTau
  • slc6a6
  • TAU
  • Tau
  • tau
  • taut
  • wu:fc26e12
  • xtp

Gene-IDs for different species

4137 Homo sapiens
17762 Mus musculus
29477 Rattus norvegicus
281296 Bos taurus
398307 Xenopus laevis
426737 Gallus gallus
450177 Pan troglodytes
480488 Canis lupus familiaris
5580230 Aedes aegypti
6046480 Culex quinquefasciatus
100054638 Equus caballus
100306810 Salmo salar
100860820 Capra hircus
574327 Macaca mulatta
100735442 Cavia porcellus
569098 Danio rerio
100344003 Oryctolagus cuniculus

Protein level used designations for MAPT

  • G protein beta1/gamma2 subunit-interacting factor 1
  • PHF-tau
  • neurofibrillary tangle protein
  • paired helical filament-tau
  • Tau microtubule-associated protein
  • microtubule associated protein tau
  • tau-like protein
  • tau-like protein-2
  • microtubule-associated protein tau
  • Microtubule-associated protein tau
  • Neurofibrillary tangle protein
  • Paired helical filament-tau
  • fc26e12
  • sodium- and chloride-dependent taurine transporter
  • solute carrier family 6 (neurotransmitter transporter, taurine), member 6
  • solute carrier family 6 (neurotransmitter transporter, taurine), member 6b
  • taurine transporter
Other products related to MAPT such as antibodies, ELISA kits and high-purity proteins are available on our partner website