MCL-1 (Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1, MCL1)

Short Description: This gene encodes an anti-apoptotic protein, which is a member of the Bcl-2 family. Alternative splicing results in multiple transcript variants. The longest gene product (isoform 1) enhances cell survival by inhibiting apoptosis while the alternatively spliced shorter gene products (isoform 2 and isoform 3) promote apoptosis and are death-inducing. [provided by RefSeq, Oct 2010].
More information related to gene MCL-1.
Products related to MCL-1 Gene:
Data Quality
  • 3
Type
  • 125
  • 3
Species
  • 65
  • 31
  • 26
  • 4
  • 2
Application
  • 82
  • 37
  • 18
  • 18
  • 1
Fusion tag
  • 52
  • 17
  • 14
  • 11
  • 6
Vector Backbone
  • 8
  • 8
  • 8
  • 6
  • 6
Vector
  • 50
  • 40
  • 12
  • 9
  • 9
Insert
  • 48
  • 43
  • 16
  • 10
  • 6
Oligo-Type
  • 2
  • 1
Resistance Gene
  • 48
  • 44
  • 28
  • 5
  • 2
Expression Type
  • 103
  • 49
  • 11
Selectable Marker
  • 26
  • 23
  • 11
  • 1
Promoter
  • 36
  • 30
  • 27
  • 13
  • 10
Format
  • 51
  • 27
  • 27
  • 23
128 Products

Type:
ORF
Application:
Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Species:
Human
Synonyms:
MCL1, Mcl1, mcl1a
Insert length:
1053 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5725476
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
NCBI Accession:
NM_021960,NP_068779
Species:
Human
Synonyms:
MCL1, Mcl1, mcl1a
Insert length:
1053 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5352791
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
NCBI Accession:
NM_021960
Gene ID:
4170 (Human, MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Insert length:
1053 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4937807
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
373102 (Zebrafish (Danio rerio), MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4073535
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
58122 (Zebrafish (Danio rerio), MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071701
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
17210 (Mouse (Murine), MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809553
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
17210 (Mouse (Murine), MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809552
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
4170 (Human, MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4035011
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
4170 (Human, MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4085327
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
4170 (Human, MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4085329
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
17210 (Mouse (Murine), MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4216030
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
788087 (Cow (Bovine), MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4069861
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
60430 (Rat (Rattus), MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046771
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
NCBI Accession:
NM_021960
Species:
Human
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887319
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1
Species:
Human
Synonyms:
BCL2L3, EAT, MCL1-ES, MCL1L, MCL1S, Mcl-1, TM, bcl2-L-3, mcl1/EAT, AW556805, mcl-1, fb72f02, wu:fb70a08, wu:fb72f02, zfMLP1, zfMcl-1a, zgc:109835
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188625
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
373102 (Zebrafish (Danio rerio), MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4073534
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
58122 (Zebrafish (Danio rerio), MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071700
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
17210 (Mouse (Murine), MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809551
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
17210 (Mouse (Murine), MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809550
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1)
Gene ID:
4170 (Human, MCL1)
Synonyms:
MCL1, Mcl1, mcl1a
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4035012
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to MCL-1

  • MCL1, BCL2 family apoptosis regulator (MCL1)
  • myeloid cell leukemia sequence 1 (Mcl1)
  • MCL1, BCL2 family apoptosis regulator (Mcl1)
  • MCL1, BCL2 family apoptosis regulator a (mcl1a)
  • AW556805
  • bcl2-L-3
  • BCL2L3
  • EAT
  • fb72f02
  • mcl-1
  • Mcl-1
  • MCL1-ES
  • mcl1/EAT
  • MCL1L
  • MCL1S
  • TM
  • wu:fb70a08
  • wu:fb72f02
  • zfMcl-1a
  • zfMLP1
  • zgc:109835

Gene-IDs for different species

GENE IDSPECIES
4170 Homo sapiens
17210 Mus musculus
60430 Rattus norvegicus
403537 Canis lupus familiaris
493970 Felis catus
397648 Sus scrofa
788087 Bos taurus
58122 Danio rerio
100721658 Cavia porcellus

Protein level used designations for MCL-1

  • bcl-2-like protein 3
  • bcl-2-related protein EAT/mcl1
  • induced myeloid leukemia cell differentiation protein Mcl-1
  • myeloid cell leukemia ES
  • induced myeloid leukemia cell differentiation protein Mcl-1 homolog
  • myeloid cell leukemia protein 1
  • fb70a08
  • BCL2 family apoptosis regulator
  • LOW QUALITY PROTEIN: induced myeloid leukemia cell differentiation protein Mcl-1
  • myeloid cell leukemia sequence 1 (BCL2-related)
Other products related to MCL-1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com