MLLT1 (Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1, MLLT1)

Short Description: Capable of activating transcription from synthetic reporter genes in both lymphoid and myeloid cells.
More information related to gene MLLT1.
Products related to MLLT1 Gene:
77 Products
Data Quality
  • 1
Type
  • 73
  • 4
Species
  • 26
  • 25
  • 22
  • 2
  • 2
Application
  • 39
  • 21
  • 17
  • 16
Fusion tag
  • 33
  • 11
  • 7
  • 6
  • 6
Vector Backbone
  • 6
  • 6
  • 4
  • 3
  • 3
Vector
  • 27
  • 21
  • 9
  • 8
  • 5
Insert
  • 24
  • 17
  • 16
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 32
  • 23
  • 12
  • 6
  • 2
Expression Type
  • 68
  • 41
Selectable Marker
  • 24
  • 18
Promoter
  • 29
  • 19
  • 9
  • 8
  • 8
Format
  • 31
  • 19
  • 15
  • 12

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
Gene ID:
100158574 (Xenopus tropicalis, MLLT1)
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874383
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
Gene ID:
447347 (Xenopus laevis, MLLT1)
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884371
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
NCBI Accession:
NM_005934
Species:
Human
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Insert length:
1680 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5755798
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
Gene ID:
100158574 (Xenopus tropicalis, MLLT1)
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874382
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
Gene ID:
447347 (Xenopus laevis, MLLT1)
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884372
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
Gene ID:
4298 (Human, MLLT1)
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3415929
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
Gene ID:
4298 (Human, MLLT1)
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3415960
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
Gene ID:
4298 (Human, MLLT1)
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3416325
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
NCBI Accession:
NM_005934,NP_005925
Species:
Human
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Insert length:
1680 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5451616
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1
Species:
Human
Synonyms:
MGC84026, MLLT1, ENL, LTG19, YEATS1, AA407901, BAM11
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • MLLT1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3342695
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1
Species:
Rat (Rattus)
Synonyms:
MGC84026, MLLT1, ENL, LTG19, YEATS1, AA407901, BAM11
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Mllt1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3351561
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1
Species:
Mouse (Murine)
Synonyms:
MGC84026, MLLT1, ENL, LTG19, YEATS1, AA407901, BAM11
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Mllt1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3264657
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
NCBI Accession:
NM_005934
Species:
Human
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MLLT1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5148653
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
NCBI Accession:
NM_022328
Species:
Mouse (Murine)
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mllt1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5148655
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
NCBI Accession:
NM_001106876
Species:
Rat (Rattus)
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mllt1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5148657
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
Gene ID:
4298 (Human, MLLT1)
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5056191

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5037246
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1
Gene ID:
4298 (Human, MLLT1)
Synonyms:
MGC84026, MLLT1, ENL, LTG19, YEATS1, AA407901, BAM11
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5799906
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
NCBI Accession:
NM_005934
Species:
Human
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MLLT1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5264197
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
NCBI Accession:
NM_022328
Species:
Mouse (Murine)
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mllt1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5264199
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myeloid/lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila), Translocated To, 1 (MLLT1)
NCBI Accession:
NM_001106876
Species:
Rat (Rattus)
Synonyms:
Mllt1, MLLT1, mllt1.L, mllt1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mllt1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5264201
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to MLLT1

  • MLLT1, super elongation complex subunit (Mllt1)
  • MLLT1, super elongation complex subunit (MLLT1)
  • myeloid/lymphoid or mixed-lineage leukemia; translocated to, 1 L homeolog (mllt1.L)
  • myeloid/lymphoid or mixed-lineage leukemia; translocated to, 1 (mllt1)
  • myeloid/lymphoid or mixed-lineage leukemia; translocated to, 1 (Mllt1)
  • AA407901
  • BAM11
  • ENL
  • LTG19
  • MGC84026
  • MLLT1
  • YEATS1

Gene-IDs for different species

GENE IDSPECIES
301119 Rattus norvegicus
420089 Gallus gallus
447347 Xenopus laevis
485023 Canis lupus familiaris
504458 Bos taurus
702105 Macaca mulatta
740990 Pan troglodytes
100019539 Monodelphis domestica
100065400 Equus caballus
100158574 Xenopus (Silurana) tropicalis
4298 Homo sapiens
64144 Mus musculus

Protein level used designations for MLLT1

  • myeloid/lymphoid or mixed lineage leukemia translocation to 1 homolog
  • myeloid/lymphoid or mixed lineage-leukemia translocation to 1 homolog
  • protein ENL
  • myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
  • myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog); translocated to, 1
  • ENL/MLL fusion
  • MLLT1/MLL fusion
  • YEATS domain-containing protein 1
  • leukemia-associated protein MLLT1
  • myeloid/lymphoid or mixed lineage-leukemia translocation to 4 homolog
  • trithorax
Other products related to MLLT1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com