MNDA (Myeloid Cell Nuclear Differentiation Antigen, MNDA)

Short Description: The myeloid cell nuclear differentiation antigen (MNDA) is detected only in nuclei of cells of the granulocyte-monocyte lineage. A 200-amino acid region of human MNDA is strikingly similar to a region in the proteins encoded by a family of interferon-inducible mouse genes, designated Ifi-201, Ifi-202, and Ifi-203, that are not regulated in a cell- or tissue-specific fashion. The 1.8-kb MNDA mRNA, which contains an interferon-stimulated response element in the 5-prime untranslated region, was significantly upregulated in human monocytes exposed to interferon alpha. MNDA is located within 2,200 kb of FCER1A, APCS, CRP, and SPTA1. In its pattern of expression and/or regulation, MNDA resembles IFI16, suggesting that these genes participate in blood cell-specific responses to interferons. [provided by RefSeq, Jul 2008].
More information related to gene MNDA.
Products related to MNDA Gene:
83 Products
Data Quality
  • 1
Type
  • 81
  • 2
Species
  • 50
  • 33
Application
  • 46
  • 20
  • 15
  • 12
Fusion tag
  • 29
  • 10
  • 8
  • 7
  • 6
Vector Backbone
  • 6
  • 4
  • 4
  • 4
  • 4
Vector
  • 33
  • 24
  • 9
  • 8
  • 6
Insert
  • 29
  • 27
  • 13
  • 6
  • 4
Oligo-Type
  • 2
Resistance Gene
  • 34
  • 32
  • 12
  • 3
  • 2
Expression Type
  • 60
  • 34
  • 13
Selectable Marker
  • 24
  • 18
  • 13
Promoter
  • 21
  • 21
  • 20
  • 9
  • 6
Format
  • 39
  • 18
  • 15
  • 11
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
Species:
Human
Synonyms:
MNDA, Ifi211
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5726826
$147.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
Gene ID:
4332 (Human, MNDA)
Synonyms:
MNDA, Ifi211
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463982
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
Gene ID:
381308 (Mouse (Murine), MNDA)
Synonyms:
MNDA, Ifi211
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018310
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
Gene ID:
381308 (Mouse (Murine), MNDA)
Synonyms:
MNDA, Ifi211
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018308
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
Gene ID:
381308 (Mouse (Murine), MNDA)
Synonyms:
MNDA, Ifi211
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018309
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
NCBI Accession:
NM_002432
Species:
Human
Synonyms:
MNDA, Ifi211
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562402
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
Gene ID:
4332 (Human, MNDA)
Synonyms:
MNDA, Ifi211
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463980
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
Gene ID:
381308 (Mouse (Murine), MNDA)
Synonyms:
MNDA, Ifi211
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018305
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
Gene ID:
381308 (Mouse (Murine), MNDA)
Synonyms:
MNDA, Ifi211
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018306
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
Gene ID:
381308 (Mouse (Murine), MNDA)
Synonyms:
MNDA, Ifi211
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018307
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
Gene ID:
4332 (Human, MNDA)
Synonyms:
MNDA, Ifi211
Insert length:
1224 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5317004
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
NCBI Accession:
NM_002432
Species:
Human
Synonyms:
MNDA, Ifi211
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3956042
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
NCBI Accession:
NM_002432
Species:
Human
Synonyms:
MNDA, Ifi211
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948167

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3956041
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
NCBI Accession:
NM_002432
Species:
Human
Synonyms:
MNDA, Ifi211
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948166

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3956039
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
NCBI Accession:
NM_002432
Species:
Human
Synonyms:
MNDA, Ifi211
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3956033
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
NCBI Accession:
NM_002432
Species:
Human
Synonyms:
MNDA, Ifi211
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3956036
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
NCBI Accession:
NM_002432
Species:
Human
Synonyms:
MNDA, Ifi211
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3956035
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
NCBI Accession:
NM_002432
Species:
Human
Synonyms:
MNDA, Ifi211
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3956037
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
NCBI Accession:
NM_002432
Species:
Human
Synonyms:
MNDA, Ifi211
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948168

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3956043
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Myeloid Cell Nuclear Differentiation Antigen (MNDA)
NCBI Accession:
NM_002432
Species:
Human
Synonyms:
MNDA, Ifi211
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3956045
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to MNDA

  • myeloid cell nuclear differentiation antigen (MNDA)
  • interferon activated gene 211 (Ifi211)
  • A730048F03
  • Ifi205b
  • PYHIN3

Gene-IDs for different species

GENE IDSPECIES
4332 Homo sapiens
381308 Mus musculus

Protein level used designations for MNDA

  • ifi-205-B
  • interferon activated
  • interferon-activable protein 205-B
  • interferon-inducible protein p205-B
  • lipopolysaccharide-inducible
  • protein D3
Other products related to MNDA such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com