MRPS2 (Mitochondrial Ribosomal Protein S2, MRPS2)

Short Description: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S2 family. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012].
More information related to gene MRPS2.
Products related to MRPS2 Gene:
125 Products
  • 122
  • 3
  • 56
  • 39
  • 25
  • 2
  • 2
  • 73
  • 33
  • 22
  • 16
  • 1
Fusion tag
  • 39
  • 17
  • 14
  • 12
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
  • 47
  • 40
  • 16
  • 9
  • 7
  • 46
  • 40
  • 20
  • 8
  • 6
  • 2
  • 1
Resistance Gene
  • 52
  • 40
  • 24
  • 6
  • 2
Expression Type
  • 103
  • 54
  • 13
Selectable Marker
  • 28
  • 26
  • 13
  • 1
  • 38
  • 30
  • 24
  • 16
  • 8
  • 48
  • 36
  • 24
  • 17
Supplier: Log in to see

Mitochondrial Ribosomal Protein S2 (MRPS2)
Mrps2, MRPS2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5761518
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Mitochondrial Ribosomal Protein S2 (MRPS2)
Gene ID:
51116 (Human, MRPS2)
Mrps2, MRPS2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3814209
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Mitochondrial Ribosomal Protein S2 (MRPS2)
Gene ID:
118451 (Mouse (Murine), MRPS2)
Mrps2, MRPS2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3876480
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Mitochondrial Ribosomal Protein S2 (MRPS2)
Gene ID:
505681 (Cow (Bovine), MRPS2)
Mrps2, MRPS2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3854522
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Mitochondrial Ribosomal Protein S2 (MRPS2)
Gene ID:
443704 (Xenopus laevis, MRPS2)
Mrps2, MRPS2
Vector type:
Cloning Vector
Vector backbone:
pBluescript SK-
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3468723
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Mitochondrial Ribosomal Protein S2 (MRPS2)
Gene ID:
51116 (Human, MRPS2)
Mrps2, MRPS2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4090835
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Mitochondrial Ribosomal Protein S2 (MRPS2)
NCBI Accession:
Mouse (Murine)
Mrps2, MRPS2
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Catalog No. ABIN3888619
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Quantitative real-time PCR
Mitochondrial Ribosomal Protein S2
Mouse (Murine)
MRP-S2, S2mt, 1500019M10Rik
-20 °C
Catalog No. ABIN3194996
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Mitochondrial Ribosomal Protein S2 (MRPS2)
Gene ID:
118451 (Mouse (Murine), MRPS2)
Mrps2, MRPS2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3831630
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Mitochondrial Ribosomal Protein S2 (MRPS2)
Gene ID:
51116 (Human, MRPS2)
Mrps2, MRPS2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3814208
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Mitochondrial Ribosomal Protein S2 (MRPS2)
Gene ID:
505681 (Cow (Bovine), MRPS2)
Mrps2, MRPS2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3854521
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Mitochondrial Ribosomal Protein S2 (MRPS2)
Gene ID:
51116 (Human, MRPS2)
Mrps2, MRPS2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4090834
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Mitochondrial Ribosomal Protein S2 (MRPS2)
Gene ID:
51116 (Human, MRPS2)
Mrps2, MRPS2
Insert length:
891 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5316151
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Protein Expression
Mitochondrial Ribosomal Protein S2 (MRPS2)
NCBI Accession:
Mrps2, MRPS2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3317885
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Protein Expression
Mitochondrial Ribosomal Protein S2 (MRPS2)
Mrps2, MRPS2
Insert length:
891 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4478273
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mitochondrial Ribosomal Protein S2 (MRPS2)
Mrps2, MRPS2
Insert length:
891 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4621744
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mitochondrial Ribosomal Protein S2 (MRPS2)
Mrps2, MRPS2
Insert length:
891 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4769941
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Protein Expression
Mitochondrial Ribosomal Protein S2 (MRPS2)
Mrps2, MRPS2
Insert length:
891 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4439368
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mitochondrial Ribosomal Protein S2 (MRPS2)
Mrps2, MRPS2
Insert length:
891 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4706429
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mitochondrial Ribosomal Protein S2 (MRPS2)
Mrps2, MRPS2
Insert length:
891 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4835559
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to MRPS2

  • mitochondrial ribosomal protein S2 (Mrps2)
  • mitochondrial ribosomal protein S2 (MRPS2)
  • 1500019M10Rik
  • MRP-S2
  • S2mt

Gene-IDs for different species

362094 Rattus norvegicus
51116 Homo sapiens
118451 Mus musculus
505681 Bos taurus

Protein level used designations for MRPS2

  • 28S ribosomal protein S2, mitochondrial
  • MRP-S2
  • S2mt
Other products related to MRPS2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website