NAGA (N-Acetylgalactosaminidase, alpha, NAGA)

Short Description: NAGA encodes the lysosomal enzyme alpha-N-acetylgalactosaminidase, which cleaves alpha-N-acetylgalactosaminyl moieties from glycoconjugates. Mutations in NAGA have been identified as the cause of Schindler disease types I and II (type II also known as Kanzaki disease). [provided by RefSeq, Jul 2008].
More information related to gene NAGA.
Products related to NAGA Gene:
112 Products
Type
  • 107
  • 5
Species
  • 51
  • 28
  • 27
  • 2
  • 2
Application
  • 67
  • 25
  • 25
  • 16
  • 1
Fusion tag
  • 40
  • 16
  • 11
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 44
  • 35
  • 12
  • 9
  • 4
Insert
  • 39
  • 31
  • 21
  • 8
  • 6
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 45
  • 40
  • 20
  • 2
  • 2
Expression Type
  • 89
  • 50
  • 11
  • 2
Selectable Marker
  • 26
  • 25
  • 11
Promoter
  • 31
  • 31
  • 25
  • 12
  • 8
Format
  • 46
  • 24
  • 22
  • 20
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
533357 (Cow (Bovine), NAGA)
Synonyms:
Naga, NAGA
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3862205
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
443753 (Xenopus laevis, NAGA)
Synonyms:
Naga, NAGA
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3849176
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
4668 (Human, NAGA)
Synonyms:
Naga, NAGA
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4085503
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
315165 (Rat (Rattus), NAGA)
Synonyms:
Naga, NAGA
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053646
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
17939 (Mouse (Murine), NAGA)
Synonyms:
Naga, NAGA
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4216223
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
NCBI Accession:
NM_000262
Species:
Human
Synonyms:
Naga, NAGA
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3888647
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
N-Acetylgalactosaminidase, alpha
Species:
Human
Synonyms:
D22S674, GALB
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190700
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
533357 (Cow (Bovine), NAGA)
Synonyms:
Naga, NAGA
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3862207
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
443753 (Xenopus laevis, NAGA)
Synonyms:
Naga, NAGA
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3849175
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
4668 (Human, NAGA)
Synonyms:
Naga, NAGA
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4085502
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
315165 (Rat (Rattus), NAGA)
Synonyms:
Naga, NAGA
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053647
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
17939 (Mouse (Murine), NAGA)
Synonyms:
Naga, NAGA
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4216225
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
NCBI Accession:
NM_000262,NP_000253
Species:
Human
Synonyms:
Naga, NAGA
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3317909
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Species:
Human
Synonyms:
Naga, NAGA
Insert length:
1236 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4706727
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Species:
Human
Synonyms:
Naga, NAGA
Insert length:
1236 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4835857
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
4668 (Human, NAGA)
Synonyms:
Naga, NAGA
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3419712
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
4668 (Human, NAGA)
Synonyms:
Naga, NAGA
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3418000
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
4668 (Human, NAGA)
Synonyms:
Naga, NAGA
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3418285
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
Gene ID:
4668 (Human, NAGA)
Synonyms:
Naga, NAGA
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3422898
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acetylgalactosaminidase, alpha (NAGA)
NCBI Accession:
NM_001012120,NP_001012120
Species:
Rat (Rattus)
Synonyms:
Naga, NAGA
Insert length:
1248 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3331752
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to NAGA

  • alpha-N-acetylgalactosaminidase (Naga)
  • N-acetyl galactosaminidase, alpha (Naga)
  • alpha-N-acetylgalactosaminidase (NAGA)
  • D22S674
  • GALB

Gene-IDs for different species

GENE IDSPECIES
315165 Rattus norvegicus
17939 Mus musculus
4668 Homo sapiens
533357 Bos taurus
396547 Gallus gallus

Protein level used designations for NAGA

  • alpha-N-acetylgalactosaminidase
  • alpha-galactosidase B
  • Acetylgalactosaminidase, alpha-N- (alpha-galactosidase B)
Other products related to NAGA such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com