NAIF1 (Nuclear Apoptosis Inducing Factor 1, NAIF1)

Short Description: Induces apoptosis (By similarity).
More information related to gene NAIF1.
Products related to NAIF1 Gene:
82 Products
  • 79
  • 3
  • 50
  • 26
  • 2
  • 2
  • 2
  • 47
  • 20
  • 16
  • 12
  • 1
Fusion tag
  • 27
  • 11
  • 8
  • 7
  • 6
Vector Backbone
  • 4
  • 4
  • 4
  • 4
  • 4
  • 35
  • 24
  • 8
  • 6
  • 4
  • 27
  • 26
  • 14
  • 6
  • 4
  • 2
  • 1
Resistance Gene
  • 33
  • 29
  • 14
  • 3
  • 2
Expression Type
  • 62
  • 34
  • 13
Selectable Marker
  • 18
  • 16
  • 13
  • 22
  • 22
  • 21
  • 9
  • 6
  • 38
  • 18
  • 15
  • 11

Protein Expression, Cloning
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
549107 (Xenopus tropicalis, NAIF1)
NAIF1, naif1, naif1.S, Naif1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3864973
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
510689 (Cow (Bovine), NAIF1)
NAIF1, naif1, naif1.S, Naif1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3857054
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
779282 (Xenopus laevis, NAIF1)
NAIF1, naif1, naif1.S, Naif1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4069510
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
203245 (Human, NAIF1)
NAIF1, naif1, naif1.S, Naif1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4094881
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Nuclear Apoptosis Inducing Factor 1 (NAIF1)
NCBI Accession:
NAIF1, naif1, naif1.S, Naif1
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3562683
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
Nuclear Apoptosis Inducing Factor 1
si:ch211-51h9.9, MGC154511, C9orf90, RP11-379C10.2, bA379C10.2, H11C9ORF90, 2310007O20Rik, 4933440H19Rik
-20 °C
Catalog No. ABIN3193275
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Nuclear Apoptosis Inducing Factor 1 (NAIF1)
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5749129
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression, Cloning
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
549107 (Xenopus tropicalis, NAIF1)
NAIF1, naif1, naif1.S, Naif1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3864972
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
510689 (Cow (Bovine), NAIF1)
NAIF1, naif1, naif1.S, Naif1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3857052
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
779282 (Xenopus laevis, NAIF1)
NAIF1, naif1, naif1.S, Naif1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4069509
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
203245 (Human, NAIF1)
NAIF1, naif1, naif1.S, Naif1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4094882
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
203245 (Human, NAIF1)
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5313113
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4478469
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Nuclear Apoptosis Inducing Factor 1 (NAIF1)
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4621940
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Nuclear Apoptosis Inducing Factor 1 (NAIF1)
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4770137
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4439564
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Nuclear Apoptosis Inducing Factor 1 (NAIF1)
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4706733
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Nuclear Apoptosis Inducing Factor 1 (NAIF1)
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4835863
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
NCBI Accession:
NAIF1, naif1, naif1.S, Naif1
Insert length:
984 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5429667
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

RNA Interference
Nuclear Apoptosis Inducing Factor 1
si:ch211-51h9.9, MGC154511, C9orf90, RP11-379C10.2, bA379C10.2, H11C9ORF90, 2310007O20Rik, 4933440H19Rik
HPLC purified
Available with shipment
  • NAIF1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3313430
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to NAIF1

  • nuclear apoptosis inducing factor 1 (NAIF1)
  • nuclear apoptosis inducing factor 1 (naif1)
  • nuclear apoptosis inducing factor 1 S homeolog (naif1.S)
  • nuclear apoptosis inducing factor 1 (Naif1)
  • 2310007O20Rik
  • 4933440H19Rik
  • bA379C10.2
  • C9orf90
  • H11C9ORF90
  • MGC154511
  • RP11-379C10.2
  • si:ch211-51h9.9

Gene-IDs for different species

464761 Pan troglodytes
549107 Xenopus (Silurana) tropicalis
562755 Danio rerio
698334 Macaca mulatta
779282 Xenopus laevis
100353883 Oryctolagus cuniculus
100588158 Nomascus leucogenys
203245 Homo sapiens
417229 Gallus gallus
491322 Canis lupus familiaris
510689 Bos taurus
71254 Mus musculus
687739 Rattus norvegicus

Protein level used designations for NAIF1

  • nuclear apoptosis inducing factor 1
  • nuclear apoptosis-inducing factor 1
Other products related to NAIF1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website