NAIF1 (Nuclear Apoptosis Inducing Factor 1, NAIF1)

Short Description: Induces apoptosis (By similarity).
More information related to gene NAIF1.
Products related to NAIF1 Gene:
82 Products
Type
  • 79
  • 3
Species
  • 50
  • 26
  • 2
  • 2
  • 2
Application
  • 47
  • 20
  • 16
  • 12
  • 1
Fusion tag
  • 27
  • 11
  • 8
  • 7
  • 6
Vector Backbone
  • 4
  • 4
  • 4
  • 4
  • 4
Vector
  • 35
  • 24
  • 8
  • 6
  • 4
Insert
  • 27
  • 26
  • 14
  • 6
  • 4
Oligo-Type
  • 2
  • 1
Resistance Gene
  • 33
  • 29
  • 14
  • 3
  • 2
Expression Type
  • 62
  • 34
  • 13
Selectable Marker
  • 18
  • 16
  • 13
Promoter
  • 22
  • 22
  • 21
  • 9
  • 6
Format
  • 38
  • 18
  • 15
  • 11
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Species:
Human
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5749129
$147.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
549107 (Xenopus tropicalis, NAIF1)
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3864973
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
510689 (Cow (Bovine), NAIF1)
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3857054
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
779282 (Xenopus laevis, NAIF1)
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4069510
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
203245 (Human, NAIF1)
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094881
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
NCBI Accession:
NM_197956
Species:
Human
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562683
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Nuclear Apoptosis Inducing Factor 1
Species:
Human
Synonyms:
si:ch211-51h9.9, MGC154511, C9orf90, RP11-379C10.2, bA379C10.2, H11C9ORF90, 2310007O20Rik, 4933440H19Rik
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193275
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
549107 (Xenopus tropicalis, NAIF1)
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3864972
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
510689 (Cow (Bovine), NAIF1)
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3857052
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
779282 (Xenopus laevis, NAIF1)
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4069509
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
203245 (Human, NAIF1)
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094882
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Gene ID:
203245 (Human, NAIF1)
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5313113
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Species:
Human
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4478469
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Species:
Human
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4621940
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Species:
Human
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4770137
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Species:
Human
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4439564
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Species:
Human
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4706733
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
Species:
Human
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Insert length:
519 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4835863
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Nuclear Apoptosis Inducing Factor 1 (NAIF1)
NCBI Accession:
NM_197956,NP_931045
Species:
Human
Synonyms:
NAIF1, naif1, naif1.S, Naif1
Insert length:
984 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5429667
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Nuclear Apoptosis Inducing Factor 1
Species:
Human
Synonyms:
si:ch211-51h9.9, MGC154511, C9orf90, RP11-379C10.2, bA379C10.2, H11C9ORF90, 2310007O20Rik, 4933440H19Rik
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • NAIF1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3313430
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to NAIF1

  • nuclear apoptosis inducing factor 1 (NAIF1)
  • nuclear apoptosis inducing factor 1 (naif1)
  • nuclear apoptosis inducing factor 1 S homeolog (naif1.S)
  • nuclear apoptosis inducing factor 1 (Naif1)
  • 2310007O20Rik
  • 4933440H19Rik
  • bA379C10.2
  • C9orf90
  • H11C9ORF90
  • MGC154511
  • RP11-379C10.2
  • si:ch211-51h9.9

Gene-IDs for different species

GENE IDSPECIES
464761 Pan troglodytes
549107 Xenopus (Silurana) tropicalis
562755 Danio rerio
698334 Macaca mulatta
779282 Xenopus laevis
100353883 Oryctolagus cuniculus
100588158 Nomascus leucogenys
203245 Homo sapiens
417229 Gallus gallus
491322 Canis lupus familiaris
510689 Bos taurus
71254 Mus musculus
687739 Rattus norvegicus

Protein level used designations for NAIF1

  • nuclear apoptosis inducing factor 1
  • nuclear apoptosis-inducing factor 1
Other products related to NAIF1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com