NANP (N-Acetylneuraminic Acid Phosphatase, NANP)

Short Description: The protein encoded by this gene is an enzyme involved in the synthesis of N-acetylneuraminate (Neu5Ac), the main form of sialic acid.
More information related to gene NANP.
Products related to NANP Gene:
107 Products
Type
  • 103
  • 4
Species
  • 41
  • 30
  • 30
  • 2
  • 2
Application
  • 59
  • 31
  • 25
  • 16
Fusion tag
  • 44
  • 16
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 36
  • 35
  • 12
  • 9
  • 6
Insert
  • 41
  • 25
  • 21
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 44
  • 35
  • 18
  • 6
  • 2
Expression Type
  • 95
  • 50
Selectable Marker
  • 26
  • 24
  • 1
Promoter
  • 31
  • 31
  • 15
  • 12
  • 8
Format
  • 35
  • 27
  • 23
  • 22
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Species:
Human
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5736636
$147.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
NCBI Accession:
NM_152667,NP_689880
Species:
Human
Synonyms:
nanp, NANP, Nanp, nanp.L
Insert length:
747 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5388465
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
NCBI Accession:
NM_152667
Gene ID:
140838 (Human, NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Insert length:
747 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4937398
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
553795 (Zebrafish (Danio rerio), NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4078373
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
67311 (Mouse (Murine), NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3821231
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
67311 (Mouse (Murine), NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3876035
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
414493 (Xenopus laevis, NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3847849
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
516539 (Cow (Bovine), NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063147
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
311530 (Rat (Rattus), NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053151
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
140838 (Human, NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213807
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
NCBI Accession:
NM_001009409
Species:
Rat (Rattus)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562687
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
553795 (Zebrafish (Danio rerio), NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4078372
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
67311 (Mouse (Murine), NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3821228
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
67311 (Mouse (Murine), NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3821230
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
414493 (Xenopus laevis, NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3847848
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
516539 (Cow (Bovine), NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063148
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
311530 (Rat (Rattus), NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053150
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
140838 (Human, NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213806
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
140838 (Human, NANP)
Synonyms:
nanp, NANP, Nanp, nanp.L
Insert length:
747 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5315787
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acetylneuraminic Acid Phosphatase (NANP)
NCBI Accession:
NM_152667,NP_689880
Species:
Human
Synonyms:
nanp, NANP, Nanp, nanp.L
Insert length:
3500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, SP6 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948185

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3393653
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to NANP

  • N-acetylneuraminic acid phosphatase (nanp)
  • N-acetylneuraminic acid phosphatase (NANP)
  • N-acetylneuraminic acid phosphatase (Nanp)
  • N-acetylneuraminic acid phosphatase L homeolog (nanp.L)
  • 1600031M04Rik
  • C20orf147
  • dJ694B14.3
  • HDHD4
  • Hdhd4
  • N-acylneuraminate-9-phosphatase
  • rgd1306009
  • RGD1306009
  • zgc:111947

Gene-IDs for different species

GENE IDSPECIES
549940 Xenopus (Silurana) tropicalis
706491 Macaca mulatta
100222533 Taeniopygia guttata
100341646 Oryctolagus cuniculus
745164 Pan troglodytes
140838 Homo sapiens
67311 Mus musculus
311530 Rattus norvegicus
553795 Danio rerio
414493 Xenopus laevis
421467 Gallus gallus
608182 Canis lupus familiaris
516539 Bos taurus

Protein level used designations for NANP

  • N-acylneuraminate-9-phosphatase
  • N-acetylneuraminic acid phosphatase
  • Neu5Ac-9-Pase
  • haloacid dehalogenase-like hydrolase domain containing 4
  • haloacid dehalogenase-like hydrolase domain-containing protein 4
  • neu5Ac-9-Pase
Other products related to NANP such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com