NANP (N-Acetylneuraminic Acid Phosphatase, NANP)

Short Description: The protein encoded by this gene is an enzyme involved in the synthesis of N-acetylneuraminate (Neu5Ac), the main form of sialic acid.
More information related to gene NANP.
Products related to NANP Gene:
107 Products
  • 103
  • 4
  • 41
  • 30
  • 30
  • 2
  • 2
  • 59
  • 31
  • 25
  • 16
Fusion tag
  • 44
  • 16
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
  • 36
  • 35
  • 12
  • 9
  • 6
  • 41
  • 25
  • 21
  • 8
  • 6
  • 4
Resistance Gene
  • 44
  • 35
  • 18
  • 6
  • 2
Expression Type
  • 95
  • 50
Selectable Marker
  • 26
  • 24
  • 1
  • 31
  • 31
  • 15
  • 12
  • 8
  • 35
  • 27
  • 23
  • 22

Protein Expression
N-Acetylneuraminic Acid Phosphatase (NANP)
NCBI Accession:
nanp, NANP, Nanp, nanp.L
Insert length:
747 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5388465
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Protein Expression
N-Acetylneuraminic Acid Phosphatase (NANP)
NCBI Accession:
Gene ID:
140838 (Human, NANP)
nanp, NANP, Nanp, nanp.L
Insert length:
747 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4937398
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Protein Expression, Cloning
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
553795 (Zebrafish (Danio rerio), NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Glycerol Stock
-80 °C
Catalog No. ABIN4078373
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
67311 (Mouse (Murine), NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3821231
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
67311 (Mouse (Murine), NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3876035
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
414493 (Xenopus laevis, NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3847849
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
516539 (Cow (Bovine), NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4063147
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
311530 (Rat (Rattus), NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4053151
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
140838 (Human, NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4213807
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

N-Acetylneuraminic Acid Phosphatase (NANP)
NCBI Accession:
Rat (Rattus)
nanp, NANP, Nanp, nanp.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3562687
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Protein Expression, Cloning
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
553795 (Zebrafish (Danio rerio), NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Glycerol Stock
-80 °C
Catalog No. ABIN4078372
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

N-Acetylneuraminic Acid Phosphatase (NANP)
nanp, NANP, Nanp, nanp.L
Insert length:
747 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5736636
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression, Cloning
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
67311 (Mouse (Murine), NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3821228
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
67311 (Mouse (Murine), NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3821230
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
414493 (Xenopus laevis, NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3847848
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
516539 (Cow (Bovine), NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4063148
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
311530 (Rat (Rattus), NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4053150
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
140838 (Human, NANP)
nanp, NANP, Nanp, nanp.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4213806
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

N-Acetylneuraminic Acid Phosphatase (NANP)
Gene ID:
140838 (Human, NANP)
nanp, NANP, Nanp, nanp.L
Insert length:
747 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5315787
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
N-Acetylneuraminic Acid Phosphatase (NANP)
NCBI Accession:
nanp, NANP, Nanp, nanp.L
Insert length:
3500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, SP6 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3393653
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to NANP

  • N-acetylneuraminic acid phosphatase (nanp)
  • N-acetylneuraminic acid phosphatase (NANP)
  • N-acetylneuraminic acid phosphatase (Nanp)
  • N-acetylneuraminic acid phosphatase L homeolog (nanp.L)
  • 1600031M04Rik
  • C20orf147
  • dJ694B14.3
  • HDHD4
  • Hdhd4
  • N-acylneuraminate-9-phosphatase
  • rgd1306009
  • RGD1306009
  • zgc:111947

Gene-IDs for different species

549940 Xenopus (Silurana) tropicalis
706491 Macaca mulatta
100222533 Taeniopygia guttata
100341646 Oryctolagus cuniculus
745164 Pan troglodytes
140838 Homo sapiens
67311 Mus musculus
311530 Rattus norvegicus
553795 Danio rerio
414493 Xenopus laevis
421467 Gallus gallus
608182 Canis lupus familiaris
516539 Bos taurus

Protein level used designations for NANP

  • N-acylneuraminate-9-phosphatase
  • N-acetylneuraminic acid phosphatase
  • Neu5Ac-9-Pase
  • haloacid dehalogenase-like hydrolase domain containing 4
  • haloacid dehalogenase-like hydrolase domain-containing protein 4
  • neu5Ac-9-Pase
Other products related to NANP such as antibodies, ELISA kits and high-purity proteins are available on our partner website