NAP1L2 (Nucleosome Assembly Protein 1-Like 2, NAP1L2)

Short Description: The protein encoded by this intronless gene is a member of the nucleosome assembly protein (NAP) family. The encoded protein represents a class of tissue-specific factors that interact with chromatin to regulate neuronal cell proliferation. [provided by RefSeq, Jan 2011].
More information related to gene NAP1L2.
Products related to NAP1L2 Gene:
106 Products
Type
  • 102
  • 4
Species
  • 46
  • 32
  • 28
Application
  • 56
  • 24
  • 23
  • 16
  • 1
Fusion tag
  • 36
  • 14
  • 11
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
Vector
  • 37
  • 33
  • 12
  • 9
  • 9
Insert
  • 36
  • 30
  • 20
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 49
  • 33
  • 16
  • 4
  • 2
Expression Type
  • 81
  • 47
  • 13
Selectable Marker
  • 26
  • 23
  • 13
  • 4
Promoter
  • 30
  • 27
  • 20
  • 13
  • 8
Format
  • 46
  • 27
  • 20
  • 13

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
317247 (Rat (Rattus), NAP1L2)
Synonyms:
NAP1L2, Nap1l2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053911
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
17954 (Mouse (Murine), NAP1L2)
Synonyms:
NAP1L2, Nap1l2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988414
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
17954 (Mouse (Murine), NAP1L2)
Synonyms:
NAP1L2, Nap1l2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988413
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
4674 (Human, NAP1L2)
Synonyms:
NAP1L2, Nap1l2
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211229
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
NM_008671
Species:
Mouse (Murine)
Synonyms:
NAP1L2, Nap1l2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3888648
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Application:
Quantitative real-time PCR
Gene:
Nucleosome Assembly Protein 1-Like 2
Species:
Mouse (Murine)
Synonyms:
BPX, Bpx
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195822
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
NM_021963
Species:
Human
Synonyms:
NAP1L2, Nap1l2
Insert length:
1383 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5760221
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
317247 (Rat (Rattus), NAP1L2)
Synonyms:
NAP1L2, Nap1l2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053912
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
17954 (Mouse (Murine), NAP1L2)
Synonyms:
NAP1L2, Nap1l2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988411
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
17954 (Mouse (Murine), NAP1L2)
Synonyms:
NAP1L2, Nap1l2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988412
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
4674 (Human, NAP1L2)
Synonyms:
NAP1L2, Nap1l2
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211230
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
NM_021963,NP_068798
Species:
Human
Synonyms:
NAP1L2, Nap1l2
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3385347
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
4674 (Human, NAP1L2)
Synonyms:
NAP1L2, Nap1l2
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3411255
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
NM_021963,NP_068798
Species:
Human
Synonyms:
NAP1L2, Nap1l2
Insert length:
1383 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5465366
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Nucleosome Assembly Protein 1-Like 2
Species:
Human
Synonyms:
BPX, Bpx
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • NAP1L2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3342855
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Nucleosome Assembly Protein 1-Like 2
Species:
Rat (Rattus)
Synonyms:
BPX, Bpx
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Nap1l2 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3316494
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Nucleosome Assembly Protein 1-Like 2
Species:
Mouse (Murine)
Synonyms:
BPX, Bpx
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Nap1l2 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3271011
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
NM_008671
Species:
Mouse (Murine)
Synonyms:
NAP1L2, Nap1l2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Nap1l2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5156871
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
NM_021963
Species:
Human
Synonyms:
NAP1L2, Nap1l2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of NAP1L2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5156869
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
NM_001024789
Species:
Rat (Rattus)
Synonyms:
NAP1L2, Nap1l2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Nap1l2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5156873
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to NAP1L2

  • nucleosome assembly protein 1 like 2 (NAP1L2)
  • nucleosome assembly protein 1-like 2 (Nap1l2)
  • BPX
  • Bpx

Gene-IDs for different species

GENE IDSPECIES
473666 Pan troglodytes
701017 Macaca mulatta
100400148 Callithrix jacchus
100437877 Pongo abelii
4674 Homo sapiens
17954 Mus musculus
491959 Canis lupus familiaris
317247 Rattus norvegicus

Protein level used designations for NAP1L2

  • nucleosome assembly protein 1-like 2
  • brain specific gene BPX
  • brain-specific protein, X-linked
Other products related to NAP1L2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com