NAP1L2 (Nucleosome Assembly Protein 1-Like 2, NAP1L2)

Short Description: The protein encoded by this intronless gene is a member of the nucleosome assembly protein (NAP) family. The encoded protein represents a class of tissue-specific factors that interact with chromatin to regulate neuronal cell proliferation. [provided by RefSeq, Jan 2011].
More information related to gene NAP1L2.
Products related to NAP1L2 Gene:
106 Products
  • 102
  • 4
  • 46
  • 32
  • 28
  • 56
  • 24
  • 23
  • 16
  • 1
Fusion tag
  • 36
  • 14
  • 11
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
  • 37
  • 33
  • 12
  • 9
  • 9
  • 36
  • 30
  • 20
  • 8
  • 6
  • 3
  • 1
Resistance Gene
  • 49
  • 33
  • 16
  • 4
  • 2
Expression Type
  • 81
  • 47
  • 13
Selectable Marker
  • 26
  • 23
  • 13
  • 4
  • 30
  • 27
  • 20
  • 13
  • 8
  • 46
  • 27
  • 20
  • 13
Supplier: Log in to see

Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
NAP1L2, Nap1l2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5760221
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
317247 (Rat (Rattus), NAP1L2)
NAP1L2, Nap1l2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4053911
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
17954 (Mouse (Murine), NAP1L2)
NAP1L2, Nap1l2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3988414
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
17954 (Mouse (Murine), NAP1L2)
NAP1L2, Nap1l2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3988413
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
4674 (Human, NAP1L2)
NAP1L2, Nap1l2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4211229
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
Mouse (Murine)
NAP1L2, Nap1l2
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Catalog No. ABIN3888648
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Quantitative real-time PCR
Nucleosome Assembly Protein 1-Like 2
Mouse (Murine)
BPX, Bpx
-20 °C
Catalog No. ABIN3195822
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
317247 (Rat (Rattus), NAP1L2)
NAP1L2, Nap1l2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4053912
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
17954 (Mouse (Murine), NAP1L2)
NAP1L2, Nap1l2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3988411
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
17954 (Mouse (Murine), NAP1L2)
NAP1L2, Nap1l2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3988412
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
4674 (Human, NAP1L2)
NAP1L2, Nap1l2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4211230
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
NAP1L2, Nap1l2
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3385347
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Protein Expression
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
Gene ID:
4674 (Human, NAP1L2)
NAP1L2, Nap1l2
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3411255
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
NAP1L2, Nap1l2
Insert length:
1383 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5465366
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

RNA Interference
Nucleosome Assembly Protein 1-Like 2
BPX, Bpx
HPLC purified
Available with shipment
  • NAP1L2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3342855
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

RNA Interference
Nucleosome Assembly Protein 1-Like 2
Rat (Rattus)
BPX, Bpx
HPLC purified
Available with shipment
  • Nap1l2 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3316494
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

RNA Interference
Nucleosome Assembly Protein 1-Like 2
Mouse (Murine)
BPX, Bpx
HPLC purified
Available with shipment
  • Nap1l2 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3271011
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Genome Editing with Engineered Nucleases, Protein Expression
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
Mouse (Murine)
NAP1L2, Nap1l2
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Nap1l2
Viral Particles
-80 °C
Catalog No. ABIN5156871
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Genome Editing with Engineered Nucleases, Protein Expression
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
NAP1L2, Nap1l2
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of NAP1L2
Viral Particles
-80 °C
Catalog No. ABIN5156869
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Genome Editing with Engineered Nucleases, Protein Expression
Nucleosome Assembly Protein 1-Like 2 (NAP1L2)
NCBI Accession:
Rat (Rattus)
NAP1L2, Nap1l2
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Nap1l2
Viral Particles
-80 °C
Catalog No. ABIN5156873
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
  • <
  • 1

Synonyms and alternative names related to NAP1L2

  • nucleosome assembly protein 1 like 2 (NAP1L2)
  • nucleosome assembly protein 1-like 2 (Nap1l2)
  • BPX
  • Bpx

Gene-IDs for different species

473666 Pan troglodytes
701017 Macaca mulatta
100400148 Callithrix jacchus
100437877 Pongo abelii
4674 Homo sapiens
17954 Mus musculus
491959 Canis lupus familiaris
317247 Rattus norvegicus

Protein level used designations for NAP1L2

  • nucleosome assembly protein 1-like 2
  • brain specific gene BPX
  • brain-specific protein, X-linked
Other products related to NAP1L2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website