NAPEPLD (N-Acyl Phosphatidylethanolamine phospholipase D, NAPEPLD)

Short Description: NAPEPLD is a phospholipase D type enzyme that catalyzes the release of N-acylethanolamine (NAE) from N-acyl-phosphatidylethanolamine (NAPE) in the second step of the biosynthesis of N-acylethanolamine (Okamoto et al., 2004 [PubMed 14634025]).[supplied by OMIM, Oct 2008].
More information related to gene NAPEPLD.
Products related to NAPEPLD Gene:
101 Products
Type
  • 99
  • 2
Species
  • 43
  • 28
  • 26
  • 2
  • 2
Application
  • 54
  • 24
  • 23
  • 16
Fusion tag
  • 33
  • 19
  • 13
  • 9
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 39
  • 30
  • 12
  • 9
  • 7
Insert
  • 35
  • 27
  • 21
  • 8
  • 6
Oligo-Type
  • 2
Resistance Gene
  • 37
  • 35
  • 22
  • 5
  • 2
Expression Type
  • 93
  • 50
Selectable Marker
  • 26
  • 26
Promoter
  • 37
  • 31
  • 13
  • 8
  • 7
Format
  • 37
  • 27
  • 24
  • 13

Type:
cDNA
Application:
Cloning
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
Gene ID:
222236 (Human, NAPEPLD)
Synonyms:
NAPEPLD, Napepld
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3802802
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
Gene ID:
100137693 (Xenopus laevis, NAPEPLD)
Synonyms:
NAPEPLD, Napepld
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4070942
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
Species:
Human
Synonyms:
NAPEPLD, Napepld
Insert length:
1182 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5756087
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
Gene ID:
222236 (Human, NAPEPLD)
Synonyms:
NAPEPLD, Napepld
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3802803
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
Gene ID:
100137693 (Xenopus laevis, NAPEPLD)
Synonyms:
NAPEPLD, Napepld
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4070943
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
Gene ID:
222236 (Human, NAPEPLD)
Synonyms:
NAPEPLD, Napepld
Insert length:
1182 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5322105
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
Species:
Human
Synonyms:
NAPEPLD, Napepld
Insert length:
1182 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4478480
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
Species:
Human
Synonyms:
NAPEPLD, Napepld
Insert length:
1182 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4621951
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
Species:
Human
Synonyms:
NAPEPLD, Napepld
Insert length:
1182 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4770148
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
Species:
Human
Synonyms:
NAPEPLD, Napepld
Insert length:
1182 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4439575
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
Species:
Human
Synonyms:
NAPEPLD, Napepld
Insert length:
1182 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4706750
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
Species:
Human
Synonyms:
NAPEPLD, Napepld
Insert length:
1182 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4835880
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
Gene ID:
222236 (Human, NAPEPLD)
Synonyms:
NAPEPLD, Napepld
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3428828
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
NCBI Accession:
NM_199381,NP_955413
Species:
Rat (Rattus)
Synonyms:
NAPEPLD, Napepld
Insert length:
1191 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3331794
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
NCBI Accession:
NM_198990,NP_945341
Species:
Human
Synonyms:
NAPEPLD, Napepld
Insert length:
1182 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5452540
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
NCBI Accession:
NM_199381,NP_955413
Species:
Rat (Rattus)
Synonyms:
NAPEPLD, Napepld
Insert length:
1256 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5452542
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D
Species:
Mouse (Murine)
Synonyms:
FMP30, NAPE-PLD, A530089G06, Mbldc1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • AB112350 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3269324
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
NCBI Accession:
NM_198990
Species:
Human
Synonyms:
NAPEPLD, Napepld
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of NAPEPLD
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5149185
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
NCBI Accession:
NM_178728
Species:
Mouse (Murine)
Synonyms:
NAPEPLD, Napepld
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Napepld
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5149187
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
N-Acyl Phosphatidylethanolamine phospholipase D (NAPEPLD)
NCBI Accession:
NM_199381
Species:
Rat (Rattus)
Synonyms:
NAPEPLD, Napepld
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Napepld
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5149189
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to NAPEPLD

  • N-acyl phosphatidylethanolamine phospholipase D (NAPEPLD)
  • N-acyl phosphatidylethanolamine phospholipase D (Napepld)
  • A530089G06
  • FMP30
  • Mbldc1
  • NAPE-PLD

Gene-IDs for different species

GENE IDSPECIES
222236 Homo sapiens
242864 Mus musculus
296757 Rattus norvegicus
541291 Bos taurus

Protein level used designations for NAPEPLD

  • N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D
  • NAPE-hydrolyzing phospholipase D
  • Metallo-beta-lactamase domain containing 1
Other products related to NAPEPLD such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com